LXL04_021843 | RubberDandelionOmics

Gene overview

LXL04_021843

Reference: OH-1004 Chr: Chr04 Coordinates: 138486817-138489269 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1368 bp · LXL04_021843|LXL04_021843|OH1004|cDNA

ATGAGGAAAAGGGCTCGTGTTGCACAAAACAAGGGGGATCATCATCAACATGATTTTAATTCGAATGATTTCATCAGCCGAATGCCGGATGATATTCTTATCTCTATACTATCTCGTCTGTCTCTAAAGGAAGCAACAACCACCAGCAATCTCTCAACAAGATGGAGATACTTATGGTGTCAAACAGACGGTTTAGACTTCGATGCCAATGAGAAGTTAGATAAAATAGCAAAGGATCCGAAATCACGCATCACAGAAAG...

CDS

Download CDS FASTA

1368 bp · LXL04_021843|LXL04_021843|OH1004|CDS

ATGAGGAAAAGGGCTCGTGTTGCACAAAACAAGGGGGATCATCATCAACATGATTTTAATTCGAATGATTTCATCAGCCGAATGCCGGATGATATTCTTATCTCTATACTATCTCGTCTGTCTCTAAAGGAAGCAACAACCACCAGCAATCTCTCAACAAGATGGAGATACTTATGGTGTCAAACAGACGGTTTAGACTTCGATGCCAATGAGAAGTTAGATAAAATAGCAAAGGATCCGAAATCACGCATCACAGAAAG...

Protein

Download Protein FASTA

455 aa · LXL04_021843|LXL04_021843|OH1004|PROTEIN

MRKRARVAQNKGDHHQHDFNSNDFISRMPDDILISILSRLSLKEATTTSNLSTRWRYLWCQTDGLDFDANEKLDKIAKDPKSRITERPKYINWVNRVTRQHKAPTIISFRISFDLDKSSKGAIDKWVDFAISKRVQKLELDLLENGETLRQPPKNYVFPIKSINLPKLVYRRETELKFLKSLFLKCVNVSEEAFGKLLTNCSGLQHLSIHGSGDLVNVKINGPSLVLKYFEIVFCFGVKSIEIKDVKIESFSYLGPGITI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021843`
TK1151 ID	TkA05G429030
OH-1004 ID	LXL04_021843
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021843

Location Chr04:138486817-138489269 (-)

Description Similar to At2g04230: F-box/FBD/LRR-repeat protein At2g04230

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g04230`	F-box/FBD/LRR-repeat protein At2g04230.	No verified direct reference in this release
`At3g59200`	F-box/LRR-repeat protein At3g59200.	No verified direct reference in this release
`At4g00160`	F-box/FBD/LRR-repeat protein At4g00160.	No verified direct reference in this release
`At5g38570`	Putative FBD-associated F-box protein At5g38570.	No verified direct reference in this release
`At5g56420`	F-box/FBD/LRR-repeat protein At5g56420.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021843 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT2G04230

ath:AT3G59200

ath:AT4G00160

ath:AT5G38570

ath:AT5G56420

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.768

Rank 1 · LXL04_021843 · OH-1004

Cytoplasm0.236

Rank 2 · LXL04_021843 · OH-1004

Cell membrane0.048

Rank 3 · LXL04_021843 · OH-1004

Endoplasmic reticulum0.046

Rank 4 · LXL04_021843 · OH-1004

Plastid0.030

Rank 5 · LXL04_021843 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646.39F-box25-60 aa

PF23622.2LRR_At1g61320_AtMIF1107-451 aa

PF24758.2LRR_At5g56370124-228 aa

PF08387.16FBD371-411 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021843	`PF00646.39`	F-box	25	60	2.2e-08	34.4
LXL04_021843	`PF23622.2`	LRR_At1g61320_AtMIF1	107	451	2.9e-28	100.1
LXL04_021843	`PF24758.2`	LRR_At5g56370	124	228	1.9e-10	41.5
LXL04_021843	`PF08387.16`	FBD	371	411	1.5e-10	41.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6NKX3`	Arabidopsis thaliana	F-box/FBD/LRR-repeat protein At2g04230	26.824%	Swiss-Prot	weak database homology
`Q9LX51`	Arabidopsis thaliana	F-box/LRR-repeat protein At3g59200	30.476%	Swiss-Prot	weak database homology
`Q8LF09`	Arabidopsis thaliana	F-box/FBD/LRR-repeat protein At4g00160	25.112%	Swiss-Prot	weak database homology
`Q9FFW4`	Arabidopsis thaliana	Putative FBD-associated F-box protein At5g38570	25.234%	Swiss-Prot	weak database homology
`Q9FM89`	Arabidopsis thaliana	F-box/FBD/LRR-repeat protein At5g56420	25.000%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card