LXL04_021711 | RubberDandelionOmics

Gene overview

LXL04_021711

Reference: OH-1004 Chr: Chr04 Coordinates: 135667863-135669116 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

963 bp · LXL04_021711|LXL04_021711|OH1004|cDNA

ATGGGGAACGCATCGTGTATTTTCGTGGGATGCATAGACCAAGCAAGTGTAGGAGTTGTGGAGAAATGGGGTCGGTTCGAGAAATTGGCTGAACCAGGTCTCAATTTCTTCAACCCTCTCGCCGGTCAATACCTCGCCGGAGTTCTCTCCACCAGGATCAACTCGCTCGAAGTCAAAATCGAGACCAAAACTAAGGACAACGTATTTGTTCAAATAATCTCCTCAATTCAATACCGAGTACTAAAGCAAAACGCCGATGA...

CDS

Download CDS FASTA

963 bp · LXL04_021711|LXL04_021711|OH1004|CDS

ATGGGGAACGCATCGTGTATTTTCGTGGGATGCATAGACCAAGCAAGTGTAGGAGTTGTGGAGAAATGGGGTCGGTTCGAGAAATTGGCTGAACCAGGTCTCAATTTCTTCAACCCTCTCGCCGGTCAATACCTCGCCGGAGTTCTCTCCACCAGGATCAACTCGCTCGAAGTCAAAATCGAGACCAAAACTAAGGACAACGTATTTGTTCAAATAATCTCCTCAATTCAATACCGAGTACTAAAGCAAAACGCCGATGA...

Protein

Download Protein FASTA

320 aa · LXL04_021711|LXL04_021711|OH1004|PROTEIN

MGNASCIFVGCIDQASVGVVEKWGRFEKLAEPGLNFFNPLAGQYLAGVLSTRINSLEVKIETKTKDNVFVQIISSIQYRVLKQNADDAFYELQNPREQIQAYVFDGDLLILTPASINLPQSFQSLNPLILLLLSVVRAQVPRMTLDQLFEQKDEVAKSVLQELEKVMGEYGYSIEQILMVDIIPDPSVRRAMNEINAAQRLQLASVYKGEADKILQVKRAEAEAEAKYLGGVGVARQRQAIIDGLRENILNFSHKVEGAS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021711`
TK1151 ID	TkA05G416750
OH-1004 ID	LXL04_021711
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	87.400
Protein coverage (%)	TK1151 95.261 / OH-1004 71.875 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021711

Location Chr04:135667863-135669116 (-)

Description Similar to HIR4: Hypersensitive-induced response protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g51570`	Hypersensitive-induced response protein 4.	No verified direct reference in this release
`At5g62740`	Positive regulator of hypersensitive response (HR)-like cell death.	No verified direct reference in this release
`At3g01290`	Hypersensitive-induced response protein 3.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0591900`	Positive regulator of hypersensitive response (HR)-like cell death.	No verified direct reference in this release
`Os09g0361200`	Positive regulator of hypersensitive response (HR)-like cell death.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021711 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002239 response to oomycetes Biological Process

GO:0009620 response to fungus Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009536 plastid Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

KEGG gene cross-reference

ath:AT3G01290

ath:AT5G51570

ath:AT5G62740

dosa:Os05g0591900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.404

Rank 1 · LXL04_021711 · OH-1004

Cytoplasm0.315

Rank 2 · LXL04_021711 · OH-1004

Endoplasmic reticulum0.217

Rank 3 · LXL04_021711 · OH-1004

Mitochondrion0.212

Rank 4 · LXL04_021711 · OH-1004

Nucleus0.120

Rank 5 · LXL04_021711 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01145.32Band_712-103 aa

PF01145.32Band_7132-212 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021711	`PF01145.32`	Band_7	12	103	2.2e-24	87.1
LXL04_021711	`PF01145.32`	Band_7	132	212	2.2e-24	87.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FHM7`	Arabidopsis thaliana	Hypersensitive-induced response protein 4	77.188%	Swiss-Prot	strong database homology
`Q9FM19`	Arabidopsis thaliana	Hypersensitive-induced response protein 1	51.899%	Swiss-Prot	strong database homology
`Q9SRH6`	Arabidopsis thaliana	Hypersensitive-induced response protein 3	51.582%	Swiss-Prot	strong database homology
`Q6L4S3`	Oryza sativa subsp. japonica	Hypersensitive-induced response protein-like protein 1	52.532%	Swiss-Prot	strong database homology
`Q6K550`	Oryza sativa subsp. japonica	Hypersensitive-induced response protein-like protein 2	52.104%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card