LXL04_021486 | RubberDandelionOmics

Gene overview

LXL04_021486

Reference: OH-1004 Chr: Chr04 Coordinates: 131093698-131099466 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3924 bp · LXL04_021486|LXL04_021486|OH1004|cDNA

ATGGTGTTTAAAGGCAGATTCTTCTCTTCAAAGAAATCTTCCGGCACTTCGAGCCCCGAGGGATCCAACAGTCCTCGATCTATTGGTTCTAACTCAAATTCTCCCATCAGATCCGAAAAGAAGAAACCCAAGTCCGCCACTAAAGAAGATCATCATCGGCCGATCGGTGGCACTTCTTCGTTTCGTCAAACTCAAGTCAAAGATGGTTTAACTCCAACTTCAAACCTAAAGAACCAGAATCAGACCAAGAAAGACGTACC...

CDS

Download CDS FASTA

3924 bp · LXL04_021486|LXL04_021486|OH1004|CDS

ATGGTGTTTAAAGGCAGATTCTTCTCTTCAAAGAAATCTTCCGGCACTTCGAGCCCCGAGGGATCCAACAGTCCTCGATCTATTGGTTCTAACTCAAATTCTCCCATCAGATCCGAAAAGAAGAAACCCAAGTCCGCCACTAAAGAAGATCATCATCGGCCGATCGGTGGCACTTCTTCGTTTCGTCAAACTCAAGTCAAAGATGGTTTAACTCCAACTTCAAACCTAAAGAACCAGAATCAGACCAAGAAAGACGTACC...

Protein

Download Protein FASTA

1307 aa · LXL04_021486|LXL04_021486|OH1004|PROTEIN

MVFKGRFFSSKKSSGTSSPEGSNSPRSIGSNSNSPIRSEKKKPKSATKEDHHRPIGGTSSFRQTQVKDGLTPTSNLKNQNQTKKDVPVATESKIHAQPQIPISTRPSSGAASTSSKSTASEVPPTVSPILASSLGLNRIKTRSGPLPRESFLAFNRDSNNNNNNANSKMSSLGASNLSKAKNSAGGDDDSFKKMGFAADKKKLPSSFENADRSSWADNVSTSDATIKSLPLRDQTPHVLGRSPLRNGESSSEAGRLKSRG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021486`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021486

Location Chr04:131093698-131099466 (+)

Description Similar to IREH1: Probable serine/threonine protein kinase IREH1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g17850`	May be involved in root hair elongation.	No verified direct reference in this release
`At1g48490`	Probable serine/threonine protein kinase IRE3.	No verified direct reference in this release
`At5g62310`	Modulates root tip growth.	No verified direct reference in this release
`At1g45160`	Probable serine/threonine protein kinase IRE4.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021486 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009826 unidimensional cell growth Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0035618 root hair Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G45160

ath:AT1G48490

ath:AT3G17850

ath:AT5G62310

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.571

Rank 1 · LXL04_021486 · OH-1004

Nucleus0.277

Rank 2 · LXL04_021486 · OH-1004

Cell membrane0.215

Rank 3 · LXL04_021486 · OH-1004

Golgi apparatus0.065

Rank 4 · LXL04_021486 · OH-1004

Mitochondrion0.049

Rank 5 · LXL04_021486 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26031.1IREH1328-446 aa

PF00069.32Pkinase899-1190 aa

PF07714.24PK_Tyr_Ser-Thr900-1046 aa

PF07714.24PK_Tyr_Ser-Thr1081-1176 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021486	`PF26031.1`	IREH1	328	446	1.8e-55	187.1
LXL04_021486	`PF00069.32`	Pkinase	899	1190	5.8e-67	226.6
LXL04_021486	`PF07714.24`	PK_Tyr_Ser-Thr	900	1046	9.5e-33	114.3
LXL04_021486	`PF07714.24`	PK_Tyr_Ser-Thr	1081	1176	9.5e-33	114.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4J6F6`	Arabidopsis thaliana	Probable serine/threonine protein kinase IREH1	62.938%	Swiss-Prot	strong database homology
`F4HYG2`	Arabidopsis thaliana	Probable serine/threonine protein kinase IRE3	58.559%	Swiss-Prot	strong database homology
`Q9LE81`	Arabidopsis thaliana	Probable serine/threonine protein kinase IRE	56.238%	Swiss-Prot	strong database homology
`F4HPN2`	Arabidopsis thaliana	Probable serine/threonine protein kinase IRE4	53.736%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card