LXL04_021314 | RubberDandelionOmics

Gene overview

LXL04_021314

Reference: OH-1004 Chr: Chr04 Coordinates: 127106908-127108171 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

552 bp · LXL04_021314|LXL04_021314|OH1004|cDNA

ATGGAGCTCGAACCAATTGCTAAAACCCTAAATAATGATTCGATCTTTCCTTTCCCATCATCCATACCCGCCACCGAAGGAGATGCTTTGTCTGCTCGATCATTTGTCAAAACTCCATTCTGCCGTCATACGGCGCCTCCGGGATCCCGAAACCGCCGTTCGCTCCACATGCGACACCGCCAAGCTCCATTGATTGCCGTTACAGAACACGAGTTAAACTCTCAGACCGCGGCAACTCTGTGTTTAGCATCGGTTGTTGA...

CDS

Download CDS FASTA

552 bp · LXL04_021314|LXL04_021314|OH1004|CDS

ATGGAGCTCGAACCAATTGCTAAAACCCTAAATAATGATTCGATCTTTCCTTTCCCATCATCCATACCCGCCACCGAAGGAGATGCTTTGTCTGCTCGATCATTTGTCAAAACTCCATTCTGCCGTCATACGGCGCCTCCGGGATCCCGAAACCGCCGTTCGCTCCACATGCGACACCGCCAAGCTCCATTGATTGCCGTTACAGAACACGAGTTAAACTCTCAGACCGCGGCAACTCTGTGTTTAGCATCGGTTGTTGA...

Protein

Download Protein FASTA

183 aa · LXL04_021314|LXL04_021314|OH1004|PROTEIN

MELEPIAKTLNNDSIFPFPSSIPATEGDALSARSFVKTPFCRHTAPPGSRNRRSLHMRHRQAPLIAVTEHELNSQTAATLCLASVVDGAPDRDPYYLKTFEAGNNFSHSALQKVQSAIVGISICELRRAVIDSIETAGGKIDYVEIVEQESLEAVEEITNGGVAMCVAQLQHDLESKEITSTT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021314`
TK1151 ID	TkA05G449050
OH-1004 ID	LXL04_021314
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	88.500
Protein coverage (%)	TK1151 87.719 / OH-1004 85.792 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021314

Location Chr04:127106908-127108171 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g48840`	Catalyzes the condensation of pantoate with beta-alanine to form pantothenate.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021314 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0015940 pantothenate biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0004592 pantoate-beta-alanine ligase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

KEGG gene cross-reference

ath:AT5G48840

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.381

Rank 1 · LXL04_021314 · OH-1004

Cytoplasm0.339

Rank 2 · LXL04_021314 · OH-1004

Cell membrane0.133

Rank 3 · LXL04_021314 · OH-1004

Mitochondrion0.115

Rank 4 · LXL04_021314 · OH-1004

Plastid0.112

Rank 5 · LXL04_021314 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24714.2TOR1L1_N61-98 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021314	`PF24714.2`	TOR1L1_N	61	98	6.3e-06	26.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FKB3`	Arabidopsis thaliana	Pantoate--beta-alanine ligase	52.273%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card