LXL04_021142 | RubberDandelionOmics

Gene overview

LXL04_021142

Reference: OH-1004 Chr: Chr04 Coordinates: 122439673-122441028 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1356 bp · LXL04_021142|LXL04_021142|OH1004|cDNA

ATGGATGGCGATCATGATGAACTGAGATTTGTGTGTAAGTTGTGTGATAAAAGATATCCAAGTGGGAAATCATTAGGTGGACATATGAGGTCTCATGTATTCGCTCCTCCTGCTGGTGCTAACTCAACTGAATCAGACGACAAATTCGAGACCTTGAAAAAGCTTCCTACTTTGATCATCAACGGAAACGGAATTGGAAACGGAAATGGGAACGGGAATGGGAATGAGAATGAGAATCCTACTAATTATGGGTTACGAGA...

CDS

Download CDS FASTA

1356 bp · LXL04_021142|LXL04_021142|OH1004|CDS

ATGGATGGCGATCATGATGAACTGAGATTTGTGTGTAAGTTGTGTGATAAAAGATATCCAAGTGGGAAATCATTAGGTGGACATATGAGGTCTCATGTATTCGCTCCTCCTGCTGGTGCTAACTCAACTGAATCAGACGACAAATTCGAGACCTTGAAAAAGCTTCCTACTTTGATCATCAACGGAAACGGAATTGGAAACGGAAATGGGAACGGGAATGGGAATGAGAATGAGAATCCTACTAATTATGGGTTACGAGA...

Protein

Download Protein FASTA

451 aa · LXL04_021142|LXL04_021142|OH1004|PROTEIN

MDGDHDELRFVCKLCDKRYPSGKSLGGHMRSHVFAPPAGANSTESDDKFETLKKLPTLIINGNGIGNGNGNGNGNENENPTNYGLRENPKKSWRAVGSSSSTLPFPNEKVCKQCGKGFQSLKALCGHMAFHSHKDRNSKDYDYSWTSENFDHDDKLISDSHSDAEENEVEDPICVTRSKSKRYKKIIVKPSSFLTNSNNSNYNYGSSSISEIDEHEQEEVAMSLMMLSKDSANWAGVSSVLESSDNNSVVLETKWNSESR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021142`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021142

Location Chr04:122439673-122441028 (-)

Description Similar to ZAT4: Zinc finger protein ZAT4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g45120`	Probable transcription factor that may be involved in stress responses.	No verified direct reference in this release
`At3g60580`	Probable transcription factor that may be involved in stress responses.	No verified direct reference in this release
`At1g02030`	Probable transcription factor that may be involved in stress responses.	No verified direct reference in this release
`At2g28200`	Probable transcription factor that may be involved in stress responses.	No verified direct reference in this release
`At3g53600`	Transcription factor involved in stress responses (Probable).	The Arabidopsis Cys2/His2 zinc finger transcription factor ZAT18 is a positive regulator of plant tolerance to drought stress.2017 · DOI: 10.1093/jxb/erx157

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021142 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006950 response to stress Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009611 response to wounding Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0010200 response to chitin Biological Process

GO:0010224 response to UV-B Biological Process

GO:0042631 cellular response to water deprivation Biological Process

GO:1902074 response to salt Biological Process

KEGG gene cross-reference

ath:AT1G02030

ath:AT2G28200

ath:AT2G45120

ath:AT3G53600

ath:AT3G60580

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.984

Rank 1 · LXL04_021142 · OH-1004

Cytoplasm0.061

Rank 2 · LXL04_021142 · OH-1004

Cell membrane0.020

Rank 3 · LXL04_021142 · OH-1004

Endoplasmic reticulum0.011

Rank 4 · LXL04_021142 · OH-1004

Plastid0.009

Rank 5 · LXL04_021142 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13912.13zf-C2H2_69-32 aa

PF13912.13zf-C2H2_6110-131 aa

PF13912.13zf-C2H2_6343-367 aa

PF13912.13zf-C2H2_6393-415 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021142	`PF13912.13`	zf-C2H2_6	9	32	5.8e-31	106.5
LXL04_021142	`PF13912.13`	zf-C2H2_6	110	131	5.8e-31	106.5
LXL04_021142	`PF13912.13`	zf-C2H2_6	343	367	5.8e-31	106.5
LXL04_021142	`PF13912.13`	zf-C2H2_6	393	415	5.8e-31	106.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SHD0`	Arabidopsis thaliana	Zinc finger protein ZAT4	43.284%	Swiss-Prot	weak database homology
`Q9M202`	Arabidopsis thaliana	Zinc finger protein ZAT9	44.737%	Swiss-Prot	weak database homology
`Q39092`	Arabidopsis thaliana	Zinc finger protein ZAT1	45.690%	Swiss-Prot	weak database homology
`Q681X4`	Arabidopsis thaliana	Zinc finger protein ZAT5	37.333%	Swiss-Prot	weak database homology
`Q9LFG0`	Arabidopsis thaliana	Zinc finger protein ZAT18	40.000%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card