LXL04_021127 | RubberDandelionOmics

Gene overview

LXL04_021127

Reference: OH-1004 Chr: Chr04 Coordinates: 122108694-122111178 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1041 bp · LXL04_021127|LXL04_021127|OH1004|cDNA

CTGAAACAAGGAATGAGCGAAAGCAAACAAGCAGTCGGAAGTAAAATGGAGGCTAAGCAAACTGACATCAAACTGAAAGCCCCAGTTCGTTGCATCGTCAAACTCGGAGGTGCGGCAATCACATGTAAGAACGACTTTGAAAAGATAAATGAAAGCAATCTCGTTCAGGTTTCTTCACAGTTGCGAGAGACAATGAGGATCGGATCTTCATCCGGACCAGTACTTGAAATGGATTGGAGCAAACGCCAGGGAATTTCAGA...

CDS

Download CDS FASTA

1041 bp · LXL04_021127|LXL04_021127|OH1004|CDS

CTGAAACAAGGAATGAGCGAAAGCAAACAAGCAGTCGGAAGTAAAATGGAGGCTAAGCAAACTGACATCAAACTGAAAGCCCCAGTTCGTTGCATCGTCAAACTCGGAGGTGCGGCAATCACATGTAAGAACGACTTTGAAAAGATAAATGAAAGCAATCTCGTTCAGGTTTCTTCACAGTTGCGAGAGACAATGAGGATCGGATCTTCATCCGGACCAGTACTTGAAATGGATTGGAGCAAACGCCAGGGAATTTCAGA...

Protein

Download Protein FASTA

346 aa · LXL04_021127|LXL04_021127|OH1004|PROTEIN

MKQGMSESKQAVGSKMEAKQTDIKLKAPVRCIVKLGGAAITCKNDFEKINESNLVQVSSQLRETMRIGSSSGPVLEMDWSKRQGISEPTVTVDAFNQQEAVDYNNFVVIHGAGSFGHFQASKSGVHRGGLNQPLVKAGFVATRISVTSLNLEIVRALAREGIPSVAMSPFSCGWSTRERNIASADVSTVFEALDSGFVPVLHGDAVLDESLGCTILSGDVIISHLAAQLKPQFVVFLTDVFGVYDRPPSDPNALLLREIA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021127`
TK1151 ID	TkA05G355620
OH-1004 ID	LXL04_021127
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.000
Protein coverage (%)	TK1151 100.000 / OH-1004 98.844 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021127

Location Chr04:122108694-122111178 (-)

Description Similar to IPK: Isopentenyl phosphate kinase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g26640`	Catalyzes the formation of isopentenyl diphosphate (IPP), the universal five-carbon isoprenoid building block of all natural isoprenoids.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021127 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016114 terpenoid biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016301 kinase activity Molecular Function

GO:0102043 isopentenyl phosphate kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G26640

hvo:HVO_2762

mja:MJ_0044

mth:MTH_47

tac:Ta0103

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.493

Rank 1 · LXL04_021127 · OH-1004

Nucleus0.324

Rank 2 · LXL04_021127 · OH-1004

Plastid0.119

Rank 3 · LXL04_021127 · OH-1004

Golgi apparatus0.087

Rank 4 · LXL04_021127 · OH-1004

Cell membrane0.087

Rank 5 · LXL04_021127 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00696.34AA_kinase30-314 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021127	`PF00696.34`	AA_kinase	30	314	2.7e-35	122.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H1F7`	Arabidopsis thaliana	Isopentenyl phosphate kinase	71.069%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card