LXL04_021118 | RubberDandelionOmics

Gene overview

LXL04_021118

Reference: OH-1004 Chr: Chr04 Coordinates: 122039887-122041685 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

993 bp · LXL04_021118|LXL04_021118|OH1004|cDNA

ATGTCAGTAACCACCATTACAGCATCCACAAACAGTAGTGTCTGTGGATCTCCCGACACTTCAAGGAACCATTTCAGACTGAAAAGAAGCCACCTACTCTTCGGGACTGAAAAGAGATTCCTTTCACACCAATGTGCACAAAACCTCCAATTGGACAGATCAGGGCAACGGAATACAAGGGTTCAAGCAGGTTGGCTTTTTAAAGGCGGAGGTGAGCAGAGTTCAGATGCAAGTTTAGAGCGCAGTGATAGTGCCAATGA...

CDS

Download CDS FASTA

993 bp · LXL04_021118|LXL04_021118|OH1004|CDS

ATGTCAGTAACCACCATTACAGCATCCACAAACAGTAGTGTCTGTGGATCTCCCGACACTTCAAGGAACCATTTCAGACTGAAAAGAAGCCACCTACTCTTCGGGACTGAAAAGAGATTCCTTTCACACCAATGTGCACAAAACCTCCAATTGGACAGATCAGGGCAACGGAATACAAGGGTTCAAGCAGGTTGGCTTTTTAAAGGCGGAGGTGAGCAGAGTTCAGATGCAAGTTTAGAGCGCAGTGATAGTGCCAATGA...

Protein

Download Protein FASTA

330 aa · LXL04_021118|LXL04_021118|OH1004|PROTEIN

MSVTTITASTNSSVCGSPDTSRNHFRLKRSHLLFGTEKRFLSHQCAQNLQLDRSGQRNTRVQAGWLFKGGGEQSSDASLERSDSANEDILIFFYQLDLATRVQYALNLEEYDIAKQLRNKLNEVEAEVIKQQETKRGLSIKSEAQDKGLSLLRLRADLQNAIKNENYSVAAELRDQISTLEADSLAASIKAQAFQNAQFQFRLGQKLRHKKFGYRAVVCGMDPVCCETKTWMENANVDQLTRGPDQPYYQVLVDVQEDPN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021118`
TK1151 ID	TkA05G355350
OH-1004 ID	LXL04_021118
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021118

Location Chr04:122039887-122041685 (+)

Description Similar to CLPF: Clp protease adapter protein ClpF, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g03390`	Clp protease adapter that facilitates CLPS1 recruitment to ClpC chaperones thus forming a binary adapter for selective substrate recognition and delivery to plastid Clp protease system (CLPC).	Discovery of a Unique Clp Component, ClpF, in Chloroplasts: A Proposed Binary ClpF-ClpS1 Adaptor Complex Functions in Substrate Recognition and Delivery.2015 · DOI: 10.1105/tpc.15.00574

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021118 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0019221 cytokine-mediated signaling pathway Biological Process

GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0061484 hematopoietic stem cell homeostasis Biological Process

GO:0070371 ERK1 and ERK2 cascade Biological Process

GO:0000151 ubiquitin ligase complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009840 chloroplastic endopeptidase Clp complex Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0004842 ubiquitin-protein transferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G03390

hsa:23014

mmu:231670

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.978

Rank 1 · LXL04_021118 · OH-1004

Mitochondrion0.035

Rank 2 · LXL04_021118 · OH-1004

Cytoplasm0.024

Rank 3 · LXL04_021118 · OH-1004

Nucleus0.022

Rank 4 · LXL04_021118 · OH-1004

Peroxisome0.014

Rank 5 · LXL04_021118 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02151.26UVR153-182 aa

PF08755.17YccV-like200-296 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021118	`PF02151.26`	UVR	153	182	1e-07	32.2
LXL04_021118	`PF08755.17`	YccV-like	200	296	9.9e-29	100.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q67Y99`	Arabidopsis thaliana	Clp protease adapter protein ClpF, chloroplastic	63.939%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card