Gene Card
Gene overview
cDNA / CDS / Protein Sequences
606 bp · LXL04_021024|LXL04_021024|OH1004|cDNA
atgGAACAATTCCCAGAAAGACCATTGTTTGGTGGAGCTGTTTCAACTACTTTCCCACTTAGGTTTGAGGATGTGAGCAATATTCGAGAAGTACCTGATCATCAGGAGGTGTTTGTGGACCCCGCACGTGATGAAAGCCTGATATTTGAGCTTTTAGAGATGAAGCATGACGTGGCAGATAATGGAAGTGCCACGTGGTTTCTACAAGACCTTGCTAGAGAACAAGGTGCCGAGGGCAACATCGTAACAGAGCAATCAGA...
606 bp · LXL04_021024|LXL04_021024|OH1004|CDS
ATGGAACAATTCCCAGAAAGACCATTGTTTGGTGGAGCTGTTTCAACTACTTTCCCACTTAGGTTTGAGGATGTGAGCAATATTCGAGAAGTACCTGATCATCAGGAGGTGTTTGTGGACCCCGCACGTGATGAAAGCCTGATATTTGAGCTTTTAGAGATGAAGCATGACGTGGCAGATAATGGAAGTGCCACGTGGTTTCTACAAGACCTTGCTAGAGAACAAGGTGCCGAGGGCAACATCGTAACAGAGCAATCAGA...
Protein
Download Protein FASTA201 aa · LXL04_021024|LXL04_021024|OH1004|PROTEIN
MEQFPERPLFGGAVSTTFPLRFEDVSNIREVPDHQEVFVDPARDESLIFELLEMKHDVADNGSATWFLQDLAREQGAEGNIVTEQSDVLEVSGLQFRNMPAVMTTATAQMAISKGRQGREAQNLVKVYLANLRLQGVGTDVVITAYEPVFINPLSESARSVGEGLTVPATESGRTAVGDVFKQAVSMFRINDWNLFGADAV
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_021024 |
|---|---|
| TK1151 ID | TkA05G343150 |
| OH-1004 ID | LXL04_021024 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_021024 |
|---|---|
| Location | Chr04:119307344-119308463 (-) |
| Description | Similar to rangrf: Ran guanine nucleotide release factor |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0002027 regulation of heart rate Biological Process GO:0003254 regulation of membrane depolarization Biological Process GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process GO:0006913 nucleocytoplasmic transport Biological Process GO:0015031 protein transport Biological Process GO:0032527 protein exit from endoplasmic reticulum Biological Process GO:0060047 heart contraction Biological Process GO:0090307 mitotic spindle assembly Biological Process GO:0098905 regulation of bundle of His cell action potential Biological Process GO:0098909 regulation of cardiac muscle cell action potential involved in regulation of contraction Biological Process GO:1900825 regulation of membrane depolarization during cardiac muscle cell action potential Biological Process GO:1900827 positive regulation of membrane depolarization during cardiac muscle cell action potential Biological Process |
| KEGG gene cross-reference | bta:512506 ddi:DDB_G0285871 dre:559102 hsa:29098 mmu:57785 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF04603.19Mog17-148 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_021024 | PF04603.19 | Mog1 | 7 | 148 | 6.8e-41 | 140.6 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.