LXL04_020914 | RubberDandelionOmics

Gene overview

LXL04_020914

Reference: OH-1004 Chr: Chr04 Coordinates: 114771155-114778806 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5505 bp · LXL04_020914|LXL04_020914|OH1004|cDNA

ATGGAGCATTCTGGTTCGGCTAATTCATCAGTAGCTGGAACCAGTGGCCGTTCAGTGGCATTCGAAATTGATCTTAATGAAGCACCCCTTCCTTCTCCCCGAGAAATTGTCGGTGGCAGCGGAGCTGGTTTTGCGGCGGAGCACCGATGCGGTTCTTGCGGCGAGCTGGAAGGGTCCATGGTGATATGTGGTGATTGCGGGAGGCGGTTCCATGTCGAGTGTTTAGGCGTGAGAGAAGAGCAAAGAGAATGGAAGTGTTT...

CDS

Download CDS FASTA

5505 bp · LXL04_020914|LXL04_020914|OH1004|CDS

ATGGAGCATTCTGGTTCGGCTAATTCATCAGTAGCTGGAACCAGTGGCCGTTCAGTGGCATTCGAAATTGATCTTAATGAAGCACCCCTTCCTTCTCCCCGAGAAATTGTCGGTGGCAGCGGAGCTGGTTTTGCGGCGGAGCACCGATGCGGTTCTTGCGGCGAGCTGGAAGGGTCCATGGTGATATGTGGTGATTGCGGGAGGCGGTTCCATGTCGAGTGTTTAGGCGTGAGAGAAGAGCAAAGAGAATGGAAGTGTTT...

Protein

Download Protein FASTA

1834 aa · LXL04_020914|LXL04_020914|OH1004|PROTEIN

MEHSGSANSSVAGTSGRSVAFEIDLNEAPLPSPREIVGGSGAGFAAEHRCGSCGELEGSMVICGDCGRRFHVECLGVREEQREWKCFECLIECRSGRTSSRTAGGGCGSGLFDMNSSPPREADGVEEDYFVNSELVLAASFPKPKMQDMRRNPFFGFTLSSQMANSDMRLIASGFPSQNPSCSMTRFAHLNLETATQKGNIVYLEALKDFISEKQGVLGDGWRVKFEYSEKNYKTSAIYFAPNGTRFDSMSEVAHHLGLI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020914`
TK1151 ID	TkA05G332910
OH-1004 ID	LXL04_020914
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	96.700
Protein coverage (%)	TK1151 97.422 / OH-1004 59.815 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020914

Location Chr04:114771155-114778806 (-)

Description Similar to MBD9: Methyl-CpG-binding domain-containing protein 9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01460`	Probable transcriptional regulator that acts as a histone acetyltransferase.	AtMBD9: a protein with a methyl-CpG-binding domain regulates flowering time and shoot branching in Arabidopsis.2006 · DOI: 10.1111/j.1365-313x.2006.02691.x AtMBD9 modulates Arabidopsis development through the dual epigenetic pathways of DNA methylation and histone acetylation.2009 · DOI: 10.1111/j.1365-313x.2009.03860.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020914 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006325 chromatin organization Biological Process

GO:0006334 nucleosome assembly Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006352 DNA-templated transcription initiation Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0010223 secondary shoot formation Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031048 regulatory ncRNA-mediated heterochromatin formation Biological Process

GO:0031507 heterochromatin formation Biological Process

KEGG gene cross-reference

ath:AT3G01460

dre:406350

hsa:51773

spo:2541299

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.951

Rank 1 · LXL04_020914 · OH-1004

Cytoplasm0.103

Rank 2 · LXL04_020914 · OH-1004

Cell membrane0.032

Rank 3 · LXL04_020914 · OH-1004

Endoplasmic reticulum0.014

Rank 4 · LXL04_020914 · OH-1004

Plastid0.012

Rank 5 · LXL04_020914 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00628.36PHD50-89 aa

PF13831.13PHD_259-89 aa

PF01429.26MBD210-258 aa

PF05965.20FYRC548-574 aa

PF00628.36PHD1142-1186 aa

PF15612.12WHIM11224-1267 aa

PF15613.12WSD1366-1446 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020914	`PF00628.36`	PHD	50	89	3.3e-15	56.6
LXL04_020914	`PF13831.13`	PHD_2	59	89	2.1e-06	27.8
LXL04_020914	`PF01429.26`	MBD	210	258	2e-06	28.1
LXL04_020914	`PF05965.20`	FYRC	548	574	1.3e-06	29.2
LXL04_020914	`PF00628.36`	PHD	1142	1186	3.3e-15	56.6
LXL04_020914	`PF15612.12`	WHIM1	1224	1267	1e-09	38.5
LXL04_020914	`PF15613.12`	WSD	1366	1446	2.1e-09	38.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SGH2`	Arabidopsis thaliana	Methyl-CpG-binding domain-containing protein 9	39.353%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card