LXL04_020686 | RubberDandelionOmics

Gene overview

LXL04_020686

Reference: OH-1004 Chr: Chr04 Coordinates: 104905016-104908627 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1416 bp · LXL04_020686|LXL04_020686|OH1004|cDNA

ATGAATGCGAGAGAGGAACGAGTAATGGGTGTAGTGtcgggatcttttgagaacttatATATTCCCAAGAACCCaagaactctcaaaccgttaactttttcgaaaaaccgacttcgggggctaAGAGTTTTATTATATTTTCTAAAAATATTGATTATATTAATGAAAATACTAATTGggtATTCCCGTTTAGAACAGGCTCCCCCGGATGGCCCGGTCTTTGACCGTTGTAACAGTAAATTGAAACCGCTGTCACGTTC...

CDS

Download CDS FASTA

1416 bp · LXL04_020686|LXL04_020686|OH1004|CDS

ATGAATGCGAGAGAGGAACGAGTAATGGGTGTAGTGTCGGGATCTTTTGAGAACTTATATATTCCCAAGAACCCAAGAACTCTCAAACCGTTAACTTTTTCGAAAAACCGACTTCGGGGGCTAAGAGTTTTATTATATTTTCTAAAAATATTGATTATATTAATGAAAATACTAATTGGGTATTCCCGTTTAGAACAGGCTCCCCCGGATGGCCCGGTCTTTGACCGTTGTAACAGTAAATTGAAACCGCTGTCACGTTC...

Protein

Download Protein FASTA

471 aa · LXL04_020686|LXL04_020686|OH1004|PROTEIN

MNAREERVMGVVSGSFENLYIPKNPRTLKPLTFSKNRLRGLRVLLYFLKILIILMKILIGYSRLEQAPPDGPVFDRCNSKLKPLSRSHGFGSSAEALNTDRPNLLSYHFSHSFLSTLFLSPHHFKLFSIAMGSDKKIKIGINGFGRIGRLVARVALQRDDVELVAVNDPFISTDYMTYMFKYDSVHGQWKHNELKVKDEKTLLFGERPVTVFGIRNPEDIPWGEAGADFVVESTGVFTDKDKAAAHLKGGAKKVIISAPS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020686`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020686

Location Chr04:104905016-104908627 (-)

Description Similar to GAPC2: Glyceraldehyde-3-phosphate dehydrogenase GAPC2, cytosolic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g13440`	Key enzyme in glycolysis that catalyzes the first step of the pathway by converting D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate.	Cytosolic glyceraldehyde-3-phosphate dehydrogenases interact with phospholipase Dδ to transduce hydrogen peroxide signals in the Arabidopsis response to stress.2012 · DOI: 10.1105/tpc.111.094946
`At3g04120`	Key enzyme in glycolysis that converts D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate.	Characterization of Arabidopsis lines deficient in GAPC-1, a cytosolic NAD-dependent glyceraldehyde-3-phosphate dehydrogenase.2008 · DOI: 10.1104/pp.108.128769 Cytosolic glyceraldehyde-3-phosphate dehydrogenases interact with phospholipase Dδ to transduce hydrogen peroxide signals in the Arabidopsis response to stress.2012 · DOI: 10.1105/tpc.111.094946 Transfer of a Redox-Signal through the Cytosol by Redox-Dependent Microcompartmentation of Glycolytic Enzymes at Mitochondria and Actin Cytoskeleton.2012 · DOI: 10.3389/fpls.2012.00284 Nuclear moonlighting of cytosolic glyceraldehyde-3-phosphate dehydrogenase regulates Arabidopsis response to heat stress.2020 · DOI: 10.1038/s41467-020-17311-4

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020686 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006006 glucose metabolic process Biological Process

GO:0006094 gluconeogenesis Biological Process

GO:0006096 glycolytic process Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009408 response to heat Biological Process

GO:0009744 response to sucrose Biological Process

GO:0010154 fruit development Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0046686 response to cadmium ion Biological Process

GO:0048316 seed development Biological Process

GO:0051775 response to redox state Biological Process

KEGG gene cross-reference

ath:AT1G13440

ath:AT3G04120

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.358

Rank 1 · LXL04_020686 · OH-1004

Cytoplasm0.340

Rank 2 · LXL04_020686 · OH-1004

Mitochondrion0.138

Rank 3 · LXL04_020686 · OH-1004

Nucleus0.134

Rank 4 · LXL04_020686 · OH-1004

Peroxisome0.133

Rank 5 · LXL04_020686 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00044.31Gp_dh_N137-240 aa

PF02800.27Gp_dh_C286-451 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020686	`PF00044.31`	Gp_dh_N	137	240	2e-34	118.6
LXL04_020686	`PF02800.27`	Gp_dh_C	286	451	3.9e-75	251.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FX54`	Arabidopsis thaliana	Glyceraldehyde-3-phosphate dehydrogenase GAPC2, cytosolic	92.239%	Swiss-Prot	strong database homology
`P25858`	Arabidopsis thaliana	Glyceraldehyde-3-phosphate dehydrogenase GAPC1, cytosolic	91.940%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card