LXL04_020624 | RubberDandelionOmics

Gene overview

LXL04_020624

Reference: OH-1004 Chr: Chr04 Coordinates: 96812994-96814640 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1023 bp · LXL04_020624|LXL04_020624|OH1004|cDNA

ATGTACGGTTCCGATGGCGTAACAGAAGATTCAGAACGAACCGCCTTTCGGAAAACCGAGAAAAAGTACAAGCTATATTATGATAACACCAAATCTTCCAAAAAGAAGAAGCAACCGAGGCCTGTAGATTTATCGGAGGTTATTGATTTCAAGTCAATTTCAGAGTCCCTTACCAGAAACGGCGATCTACCTATTGGAGTTTCGAAGCTTGAATGTGACTTCGATAGGCCAGTTTTCTGCTTGGATAACTGCCCTGGTTT...

CDS

Download CDS FASTA

1023 bp · LXL04_020624|LXL04_020624|OH1004|CDS

ATGTACGGTTCCGATGGCGTAACAGAAGATTCAGAACGAACCGCCTTTCGGAAAACCGAGAAAAAGTACAAGCTATATTATGATAACACCAAATCTTCCAAAAAGAAGAAGCAACCGAGGCCTGTAGATTTATCGGAGGTTATTGATTTCAAGTCAATTTCAGAGTCCCTTACCAGAAACGGCGATCTACCTATTGGAGTTTCGAAGCTTGAATGTGACTTCGATAGGCCAGTTTTCTGCTTGGATAACTGCCCTGGTTT...

Protein

Download Protein FASTA

340 aa · LXL04_020624|LXL04_020624|OH1004|PROTEIN

MYGSDGVTEDSERTAFRKTEKKYKLYYDNTKSSKKKKQPRPVDLSEVIDFKSISESLTRNGDLPIGVSKLECDFDRPVFCLDNCPGFYFIPEALTIEEQYRWIKESLTSFPQPPNRTNHNALYGAIPDLFNAAKDRKLLVEDQNDVHGYIWACEETANTCKSIPASLLLRKLRWSTLGLQFDWSKRSYNVSLPHNEIPDALCQVAKKMAALAMPIGQEFQPEAAIVNYFASGDMLGGHLDDMEVDWSKPIVSMSLGCKAI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020624`
TK1151 ID	TkAUNG095520
OH-1004 ID	LXL04_020624
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020624

Location Chr04:96812994-96814640 (+)

Description Similar to At1g11780: Alpha-ketoglutarate-dependent dioxygenase alkB

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g11780`	May catalyze DNA N6-methyladenine (6mA) demethylation in gene-expression and seed-germination regulation.	Identification of AtALKBH1A and AtALKBH1D as DNA N 6 -adenine demethylases in Arabidopsis thaliana.2024 · DOI: 10.1016/j.plantsci.2024.112055

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020624 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002101 tRNA wobble cytosine modification Biological Process

GO:0006281 DNA repair Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006446 regulation of translational initiation Biological Process

GO:0006448 regulation of translational elongation Biological Process

GO:0009845 seed germination Biological Process

GO:0010029 regulation of seed germination Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0030154 cell differentiation Biological Process

GO:0035513 oxidative RNA demethylation Biological Process

GO:0042245 RNA repair Biological Process

GO:0048589 developmental growth Biological Process

KEGG gene cross-reference

ath:AT1G11780

ddi:DDB_G0285575

hsa:8846

mmu:211064

spo:2539935

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.621

Rank 1 · LXL04_020624 · OH-1004

Cytoplasm0.364

Rank 2 · LXL04_020624 · OH-1004

Mitochondrion0.077

Rank 3 · LXL04_020624 · OH-1004

Cell membrane0.050

Rank 4 · LXL04_020624 · OH-1004

Endoplasmic reticulum0.035

Rank 5 · LXL04_020624 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13532.132OG-FeII_Oxy_288-337 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020624	`PF13532.13`	2OG-FeII_Oxy_2	88	337	1.2e-40	140.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SA98`	Arabidopsis thaliana	DNA N(6)-methyladenine demethylase ALKBH1A	65.517%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card