LXL04_020167 | RubberDandelionOmics

Gene overview

LXL04_020167

Reference: OH-1004 Chr: Chr04 Coordinates: 54661079-54664881 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2826 bp · LXL04_020167|LXL04_020167|OH1004|cDNA

ATGACAGTAAGGAGTGCTCCTGGTACACCGGCTTCAAAAATTGAAAGAACACCCATATCAACACCTGGAGGGTCAAGAGTCCGGGAAGAGAAAATTGTTGTAACTGTACGATTGAGACCTCTAAATAAAAGGGAACAACTGGCCAAAGATAACGTATCATGGGAATGCATTGATGATCATTCAATTGTATATAAACCACAATCTCAGGAGCGTGTCCATCAACCATCTTCCTTTACATTTGATAAAGTCTTTGGCCCTAC...

CDS

Download CDS FASTA

2826 bp · LXL04_020167|LXL04_020167|OH1004|CDS

ATGACAGTAAGGAGTGCTCCTGGTACACCGGCTTCAAAAATTGAAAGAACACCCATATCAACACCTGGAGGGTCAAGAGTCCGGGAAGAGAAAATTGTTGTAACTGTACGATTGAGACCTCTAAATAAAAGGGAACAACTGGCCAAAGATAACGTATCATGGGAATGCATTGATGATCATTCAATTGTATATAAACCACAATCTCAGGAGCGTGTCCATCAACCATCTTCCTTTACATTTGATAAAGTCTTTGGCCCTAC...

Protein

Download Protein FASTA

941 aa · LXL04_020167|LXL04_020167|OH1004|PROTEIN

MTVRSAPGTPASKIERTPISTPGGSRVREEKIVVTVRLRPLNKREQLAKDNVSWECIDDHSIVYKPQSQERVHQPSSFTFDKVFGPTTVTETVYEDGVKTVALSALMGINATIFAYGQTSSGKTYTMRGITEKAVNDIYQHIMRTPERDFRIKISGLEIYNENVRDLLNSESGRNLKLLDDPEKGTVVEKLVEETATDDQHLRSLINICEAQRQVGETALNDTSSRSHQIIRLTIESTLRETSDCVRSFVSSLNFVDLAG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020167`
TK1151 ID	TkAUNG073030
OH-1004 ID	LXL04_020167
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020167

Location Chr04:54661079-54664881 (-)

Description Similar to NACK1: Kinesin-like protein NACK1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g18370`	Probable plus end-directed motor protein that functions in the NACK-PQR (ANP1-MKK6-MPK4) MAP kinase signaling pathway, which is essential for somatic cell cytokinesis, especially for the cell-plate formation and its expansion.	Expansion of the cell plate in plant cytokinesis requires a kinesin-like protein/MAPKKK complex.2002 · DOI: 10.1016/s0092-8674(02)00691-8 The AtNACK1/HINKEL and STUD/TETRASPORE/AtNACK2 genes, which encode functionally redundant kinesins, are essential for cytokinesis in Arabidopsis.2004 · DOI: 10.1111/j.1365-2443.2004.00798.x Arabidopsis kinesins HINKEL and TETRASPORE act redundantly to control cell plate expansion during cytokinesis in the male gametophyte.2008 · DOI: 10.1093/mp/ssn042 HINKEL kinesin, ANP MAPKKKs and MKK6/ANQ MAPKK, which phosphorylates and activates MPK4 MAPK, constitute a pathway that is required for cytokinesis in Arabidopsis thaliana.2010 · DOI: 10.1093/pcp/pcq135 Phosphorylation of a mitotic kinesin-like protein and a MAPKKK by cyclin-dependent kinases (CDKs) is involved in the transition to cytokinesis in plants.2011 · DOI: 10.1073/pnas.1110174108
`At3g43210`	Probable plus end-directed motor protein that functions in the NACK-PQR (ANP3-MKK6-MPK4) MAP kinase signaling pathway, which is essential for somatic cell cytokinesis, especially for the cell-plate formation and its expansion.	The AtNACK1/HINKEL and STUD/TETRASPORE/AtNACK2 genes, which encode functionally redundant kinesins, are essential for cytokinesis in Arabidopsis.2004 · DOI: 10.1111/j.1365-2443.2004.00798.x Arabidopsis kinesins HINKEL and TETRASPORE act redundantly to control cell plate expansion during cytokinesis in the male gametophyte.2008 · DOI: 10.1093/mp/ssn042 HINKEL kinesin, ANP MAPKKKs and MKK6/ANQ MAPKK, which phosphorylates and activates MPK4 MAPK, constitute a pathway that is required for cytokinesis in Arabidopsis thaliana.2010 · DOI: 10.1093/pcp/pcq135 AtMPK4 is required for male-specific meiotic cytokinesis in Arabidopsis.2011 · DOI: 10.1111/j.1365-313x.2011.04642.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0513900`	May be essential to promote the progression of cytokinesis during node-internode differentiation.	The rice mutant dwarf bamboo shoot 1: a leaky mutant of the NACK-type kinesin-like gene can initiate organ primordia but not organ development.2005 · DOI: 10.1093/pcp/pci206

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020167 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000911 cytokinesis by cell plate formation Biological Process

GO:0000919 cell plate assembly Biological Process

GO:0007018 microtubule-based movement Biological Process

GO:0007112 male meiosis cytokinesis Biological Process

GO:0009555 pollen development Biological Process

GO:0009558 embryo sac cellularization Biological Process

GO:0010245 radial microtubular system formation Biological Process

GO:0048229 gametophyte development Biological Process

GO:0051301 cell division Biological Process

GO:0005634 nucleus Cellular Component

GO:0005874 microtubule Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT1G18370

ath:AT3G43210

dosa:Os01g0513900

nta:107775653

nta:107780313

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.697

Rank 1 · LXL04_020167 · OH-1004

Nucleus0.269

Rank 2 · LXL04_020167 · OH-1004

Cell membrane0.095

Rank 3 · LXL04_020167 · OH-1004

Mitochondrion0.054

Rank 4 · LXL04_020167 · OH-1004

Golgi apparatus0.054

Rank 5 · LXL04_020167 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16796.12Microtub_bd32-168 aa

PF00225.30Kinesin37-353 aa

PF11995.14DUF3490759-921 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020167	`PF16796.12`	Microtub_bd	32	168	3.3e-22	79.8
LXL04_020167	`PF00225.30`	Kinesin	37	353	6.1e-102	341.7
LXL04_020167	`PF11995.14`	DUF3490	759	921	2e-67	226.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8S905`	Arabidopsis thaliana	Kinesin-like protein KIN-7A	74.359%	Swiss-Prot	strong database homology
`Q8LNZ2`	Arabidopsis thaliana	Kinesin-like protein KIN-7B	56.746%	Swiss-Prot	strong database homology
`Q9AWM8`	Oryza sativa subsp. japonica	Kinesin-like protein KIN-7A	64.330%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card