LXL04_020138 | RubberDandelionOmics

Gene overview

LXL04_020138

Reference: OH-1004 Chr: Chr04 Coordinates: 52958859-52961634 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1513 bp · LXL04_020138|LXL04_020138|OH1004|cDNA

ATGATGGTGGACACAACGGTGATGGCGGCTTTCTCTCTCCCATCTCCGCTCTCTACCCCTCGCCTCTCTAATTTTAGGGCATCTTCACCTCTTTTCTCGTTTCATccctccacctccacctccacctccacctccgcCCGTCGTCTTCTTATTCTTTCTAACAACAGTTTCAGCAATCCGTGCAATGTCAATTACCCTTTTCGTTCAGCATCCACATTTCTTATGTCCTCTGACGATTCCTTTGCCAGGTCTTGTTCCtc...

CDS

Download CDS FASTA

1479 bp · LXL04_020138|LXL04_020138|OH1004|CDS

ATGATGGTGGACACAACGGTGATGGCGGCTTTCTCTCTCCCATCTCCGCTCTCTACCCCTCGCCTCTCTAATTTTAGGGCATCTTCACCTCTTTTCTCGTTTCATCCCTCCACCTCCACCTCCACCTCCACCTCCGCCCGTCGTCTTCTTATTCTTTCTAACAACAGTTTCAGCAATCCGTGCAATGTCAATTACCCTTTTCGTTCAGCATCCACATTTCTTATGTCCTCTGACGATTCCTTTGCCAGGTCTTGTTCCTC...

Protein

Download Protein FASTA

492 aa · LXL04_020138|LXL04_020138|OH1004|PROTEIN

MMVDTTVMAAFSLPSPLSTPRLSNFRASSPLFSFHPSTSTSTSTSARRLLILSNNSFSNPCNVNYPFRSASTFLMSSDDSFARSCSSSSSSSSSSSTNSDANYSSPIEEDDDDDDVVGAVLDNDDYDPSPPPLPDRWDVLGLGQAMVDFSGVVDDEFLSRLGLEKGTRKVVNHEERGRVLQAMDGCSYKAAAGGSLSNTLVALARLGGHSIGGPPLNVAMAGSIGGDPLGGFYRTKLRRANVNFLSAPVKDGTTGTVIVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020138`
TK1151 ID	TkA05G143650
OH-1004 ID	LXL04_020138
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.800
Protein coverage (%)	TK1151 84.192 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_020138`
Location	Chr04:52958859-52961634 (+)
Description	Similar to slr0537: Uncharacterized sugar kinase slr0537 (Synechocystis sp. (strain PCC 6803 / Kazusa)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_020138` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006796 phosphate-containing compound metabolic process Biological Process GO:0005524 ATP binding Molecular Function GO:0016301 kinase activity Molecular Function GO:0047590 5-dehydro-2-deoxygluconokinase activity Molecular Function
KEGG gene cross-reference	mhj:MHJ_0220 mhp:MHP7448_0226 mhy:mhp152 mth:MTH_1544 syn:slr0537 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.967

Rank 1 · LXL04_020138 · OH-1004

Cytoplasm0.043

Rank 2 · LXL04_020138 · OH-1004

Mitochondrion0.043

Rank 3 · LXL04_020138 · OH-1004

Peroxisome0.030

Rank 4 · LXL04_020138 · OH-1004

Nucleus0.029

Rank 5 · LXL04_020138 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00294.30PfkB187-460 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020138	`PF00294.30`	PfkB	187	460	4.5e-40	138.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card