LXL04_020085 | RubberDandelionOmics

Gene overview

LXL04_020085

Reference: OH-1004 Chr: Chr04 Coordinates: 51369535-51372863 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1362 bp · LXL04_020085|LXL04_020085|OH1004|cDNA

ATGAACCGCTACTGCACGCACGCCACGGCTACTGATCTCAATCGACGCCTCCATCCCCTCGCGATTCCACCTCCGGCTGTTTGGCTGTGTGATTTTATACCGATAACACGGGGTGTTTGGCTGTGTGATTTTATACCGACTTCTTCCTCCTCTGCTGCCATTCTCAAAACAGCGAAACGGATTCAACGAGAGACCACATCAGGTAATCAGGTTCCACACGCATCTCGCACCACCGCTACTGCACGCACGCCTTCATTTTA...

CDS

Download CDS FASTA

1362 bp · LXL04_020085|LXL04_020085|OH1004|CDS

ATGAACCGCTACTGCACGCACGCCACGGCTACTGATCTCAATCGACGCCTCCATCCCCTCGCGATTCCACCTCCGGCTGTTTGGCTGTGTGATTTTATACCGATAACACGGGGTGTTTGGCTGTGTGATTTTATACCGACTTCTTCCTCCTCTGCTGCCATTCTCAAAACAGCGAAACGGATTCAACGAGAGACCACATCAGGTAATCAGGTTCCACACGCATCTCGCACCACCGCTACTGCACGCACGCCTTCATTTTA...

Protein

Download Protein FASTA

453 aa · LXL04_020085|LXL04_020085|OH1004|PROTEIN

MNRYCTHATATDLNRRLHPLAIPPPAVWLCDFIPITRGVWLCDFIPTSSSSAAILKTAKRIQRETTSGNQVPHASRTTATARTPSFYSKKEDEEKTREKELNELFKIVVVQPKVPPGRFCIDFDLLCAKGFKCKFSHDLNVQRKGEKIDIFSDTGYALESISFIKENRSRVQFQVVNVGLPVFSIRGNHDDPAVVDNLSAVDILSACNLVNYFGKMVLGGSGVGGSRTKAGAITCKKDFMTKSKLGQQQMRFMVPVWSCA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020085`
TK1151 ID	TkA02G402860
OH-1004 ID	LXL04_020085
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020085

Location Chr04:51369535-51372863 (-)

Description Similar to MRE11: Double-strand break repair protein MRE11

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g54260`	Core component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis.	No verified direct reference in this release
`At2g20280`	Zinc finger CCCH domain-containing protein 21.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0635900`	Core component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis.	No verified direct reference in this release
`UniProt: Q25AA3`	Core component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis.	No verified direct reference in this release
`Os01g0834700`	Zinc finger CCCH domain-containing protein 11.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020085 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0002181 cytoplasmic translation Biological Process

GO:0006303 double-strand break repair via nonhomologous end joining Biological Process

GO:0007095 mitotic G2 DNA damage checkpoint signaling Biological Process

GO:0042138 meiotic DNA double-strand break formation Biological Process

GO:0097552 mitochondrial double-strand break repair via homologous recombination Biological Process

GO:0000785 chromatin Cellular Component

GO:0000791 euchromatin Cellular Component

GO:0000795 synaptonemal complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G20280

ath:AT5G54260

dosa:Os01g0834700

dosa:Os04g0635900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.369

Rank 1 · LXL04_020085 · OH-1004

Nucleus0.361

Rank 2 · LXL04_020085 · OH-1004

Mitochondrion0.138

Rank 3 · LXL04_020085 · OH-1004

Cell membrane0.136

Rank 4 · LXL04_020085 · OH-1004

Endoplasmic reticulum0.100

Rank 5 · LXL04_020085 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01112.24Asparaginase_2329-368 aa

PF30468.1CIP7_M401-426 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020085	`PF01112.24`	Asparaginase_2	329	368	5.3e-08	33.1
LXL04_020085	`PF30468.1`	CIP7_M	401	426	6e-08	33.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9XGM2`	Arabidopsis thaliana	Double-strand break repair protein MRE11	93.750%	Swiss-Prot	weak database homology
`Q9SK74`	Arabidopsis thaliana	Zinc finger CCCH domain-containing protein 21	65.625%	Swiss-Prot	weak database homology
`Q7XQR9`	Oryza sativa subsp. japonica	Double-strand break repair protein MRE11	53.763%	Swiss-Prot	weak database homology
`Q25AA3`	Oryza sativa subsp. indica	Double-strand break repair protein MRE11	53.763%	Swiss-Prot	weak database homology
`Q0JHZ2`	Oryza sativa subsp. japonica	Zinc finger CCCH domain-containing protein 11	64.407%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card