LXL04_019987 | RubberDandelionOmics

Gene overview

LXL04_019987

Reference: OH-1004 Chr: Chr04 Coordinates: 46561674-46562675 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1002 bp · LXL04_019987|LXL04_019987|OH1004|cDNA

ATGAACGACCACACTGATGACACCTCAACCGACCCAACCACCCACCGGAAACACGCCGCCATGATCGACCGCCTATCGAACCTCCACCAAGCCCGCCTTTCCACCAAACCCAACCCTAAAGACCCGACCTTCGAGTCCACCCAATCATTTCTCACCCTCTTCACAACCTCCAAACAATCAATCGAATCCTCCCTCACCCAAATCCAACAAACCCCAAACCCAGATCCCAATTCCGACCTCGAAAAAATCTCCAATTCCAT...

CDS

Download CDS FASTA

1002 bp · LXL04_019987|LXL04_019987|OH1004|CDS

ATGAACGACCACACTGATGACACCTCAACCGACCCAACCACCCACCGGAAACACGCCGCCATGATCGACCGCCTATCGAACCTCCACCAAGCCCGCCTTTCCACCAAACCCAACCCTAAAGACCCGACCTTCGAGTCCACCCAATCATTTCTCACCCTCTTCACAACCTCCAAACAATCAATCGAATCCTCCCTCACCCAAATCCAACAAACCCCAAACCCAGATCCCAATTCCGACCTCGAAAAAATCTCCAATTCCAT...

Protein

Download Protein FASTA

333 aa · LXL04_019987|LXL04_019987|OH1004|PROTEIN

MNDHTDDTSTDPTTHRKHAAMIDRLSNLHQARLSTKPNPKDPTFESTQSFLTLFTTSKQSIESSLTQIQQTPNPDPNSDLEKISNSISDLEKLVAENSYFLPAYEVRSSLKTISDLKQTLDSVTSKVKPRKKFSFKNKPAKKPEPEPESELESKLQPESESKSSYTINDSPGFRGTENATLTKDFTGLEIREFVLSDLTNCEVKLKGRFRTLFINRVRNCKIYVGPVSGSILIEEVEGCLFVLASHQIRVHDAKGTDFYL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019987`
TK1151 ID	TkA05G110530
OH-1004 ID	LXL04_019987
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	97.200
Protein coverage (%)	TK1151 63.922 / OH-1004 97.898 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019987

Location Chr04:46561674-46562675 (-)

Description Similar to TFCC: Tubulin-folding cofactor C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g39920`	Essential tubulin-folding protein involved in the final step of the tubulin folding pathway.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019987 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000226 microtubule cytoskeleton organization Biological Process

GO:0006457 protein folding Biological Process

GO:0007021 tubulin complex assembly Biological Process

GO:0007023 post-chaperonin tubulin folding pathway Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005856 cytoskeleton Cellular Component

GO:0005874 microtubule Cellular Component

GO:0003924 GTPase activity Molecular Function

GO:0005096 GTPase activator activity Molecular Function

GO:0015631 tubulin binding Molecular Function

KEGG gene cross-reference

ath:AT4G39920

bta:515354

hsa:6903

mmu:72726

pon:100173755

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.773

Rank 1 · LXL04_019987 · OH-1004

Nucleus0.508

Rank 2 · LXL04_019987 · OH-1004

Mitochondrion0.045

Rank 3 · LXL04_019987 · OH-1004

Endoplasmic reticulum0.029

Rank 4 · LXL04_019987 · OH-1004

Peroxisome0.023

Rank 5 · LXL04_019987 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16752.11TBCC_N23-131 aa

PF07986.18TBCC191-308 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019987	`PF16752.11`	TBCC_N	23	131	3.4e-26	92.5
LXL04_019987	`PF07986.18`	TBCC	191	308	7.1e-37	126.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SMR2`	Arabidopsis thaliana	Tubulin-folding cofactor C	51.929%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card