LXL04_019938 | RubberDandelionOmics

Gene overview

LXL04_019938

Reference: OH-1004 Chr: Chr04 Coordinates: 44781948-44783758 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1275 bp · LXL04_019938|LXL04_019938|OH1004|cDNA

ATGGAGAAGCATGAATGGGGTTTCAAGGAGAATCATGAGCTGCATGCTGCTGCGGCTTTCACGATCAGAAACATCCTTGAATCCATCATGGCCAACATTGATGAAACGGCGACTGGGAAACCAATGATTCATCTCGGACATGGTGATCCTTCCGTTTATCCATGCTTCAAGCCATCTCCTGTTCTAGAAGCCGCCCTCGTTGAATCAATTCAGTCCACTAAGTTCAACGGCTACCCTCCTGGTGTTGGAGTTGATTCTGC...

CDS

Download CDS FASTA

1275 bp · LXL04_019938|LXL04_019938|OH1004|CDS

ATGGAGAAGCATGAATGGGGTTTCAAGGAGAATCATGAGCTGCATGCTGCTGCGGCTTTCACGATCAGAAACATCCTTGAATCCATCATGGCCAACATTGATGAAACGGCGACTGGGAAACCAATGATTCATCTCGGACATGGTGATCCTTCCGTTTATCCATGCTTCAAGCCATCTCCTGTTCTAGAAGCCGCCCTCGTTGAATCAATTCAGTCCACTAAGTTCAACGGCTACCCTCCTGGTGTTGGAGTTGATTCTGC...

Protein

Download Protein FASTA

424 aa · LXL04_019938|LXL04_019938|OH1004|PROTEIN

MEKHEWGFKENHELHAAAAFTIRNILESIMANIDETATGKPMIHLGHGDPSVYPCFKPSPVLEAALVESIQSTKFNGYPPGVGVDSARSAIAEYLTRELPYKLTSDDVFLTAGANHGIEVLLTFLSRPGANILFPRPNYPIYEARARFSPLEVRHFDLLPEKGWEVDLEGVKALADKNTVAIVLINPGNPCGNVFTVDHMRKIAEIARELRILVVADEVYAHQVFGQKPFIPMGVFGDIAPVVTLGSLSKRWIIPGWRFG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019938`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019938

Location Chr04:44781948-44783758 (-)

Description Similar to NAAT1: Nicotianamine aminotransferase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g53970`	Probable aminotransferase TAT2.	No verified direct reference in this release
`At2g20610`	C-S lyase involved in glucosinolate biosynthesis.	Arabidopsis mutants in the C-S lyase of glucosinolate biosynthesis establish a critical role for indole-3-acetaldoxime in auxin homeostasis.2004 · DOI: 10.1111/j.1365-313x.2004.02002.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0306401`	Involved in biosynthesis of mugineic acid family phytosiderophores, which are ferric iron chelators produced in graminaceous plants in response to iron deficiency.	Identification and localisation of the rice nicotianamine aminotransferase gene OsNAAT1 expression suggests the site of phytosiderophore synthesis in rice.2008 · DOI: 10.1007/s11103-007-9262-8

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019938 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001560 regulation of cell growth by extracellular stimulus Biological Process

GO:0006572 L-tyrosine catabolic process Biological Process

GO:0009684 indoleacetic acid biosynthetic process Biological Process

GO:0010189 vitamin E biosynthetic process Biological Process

GO:0019761 glucosinolate biosynthetic process Biological Process

GO:0048830 adventitious root development Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0004838 L-tyrosine-2-oxoglutarate transaminase activity Molecular Function

GO:0016846 carbon-sulfur lyase activity Molecular Function

KEGG gene cross-reference

ag:BAA87052

ag:BAA87053

ath:AT2G20610

ath:AT5G53970

dosa:Os02g0306401

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.664

Rank 1 · LXL04_019938 · OH-1004

Nucleus0.172

Rank 2 · LXL04_019938 · OH-1004

Endoplasmic reticulum0.094

Rank 3 · LXL04_019938 · OH-1004

Peroxisome0.083

Rank 4 · LXL04_019938 · OH-1004

Mitochondrion0.058

Rank 5 · LXL04_019938 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00155.28Aminotran_1_242-395 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019938	`PF00155.28`	Aminotran_1_2	42	395	1.6e-55	189.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FN30`	Arabidopsis thaliana	Probable aminotransferase TAT2	54.433%	Swiss-Prot	strong database homology
`Q9SIV0`	Arabidopsis thaliana	S-alkyl-thiohydroximate lyase SUR1	50.852%	Swiss-Prot	strong database homology
`A0A0P0VI36`	Oryza sativa subsp. japonica	Nicotianamine aminotransferase 1	54.839%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card