LXL04_019419 | RubberDandelionOmics

Gene overview

LXL04_019419

Reference: OH-1004 Chr: Chr04 Coordinates: 30965107-30968835 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

951 bp · LXL04_019419|LXL04_019419|OH1004|cDNA

ATGGCGACAATCAAAGTACCAGAAGTAGTTCCTTCTCCTACCCAAGACTCGGAAACTATCCACGAGGCTTTACAtgGCTTCATAATTGATACGAAGGCTGTGATTAAAGTACTCGGTCATAGGAATACAACCCAAAGAAAGATCATCCGAGACACTTATCGAGAATTATACAATCAAGATCTTATTGATGCTCTCCATTCTAAGATTACCTTTAATTTTGGGAGAGCAGTGGTCTTGTGGACATATGATCCATCTGAAAG...

CDS

Download CDS FASTA

951 bp · LXL04_019419|LXL04_019419|OH1004|CDS

ATGGCGACAATCAAAGTACCAGAAGTAGTTCCTTCTCCTACCCAAGACTCGGAAACTATCCACGAGGCTTTACATGGCTTCATAATTGATACGAAGGCTGTGATTAAAGTACTCGGTCATAGGAATACAACCCAAAGAAAGATCATCCGAGACACTTATCGAGAATTATACAATCAAGATCTTATTGATGCTCTCCATTCTAAGATTACCTTTAATTTTGGGAGAGCAGTGGTCTTGTGGACATATGATCCATCTGAAAG...

Protein

Download Protein FASTA

316 aa · LXL04_019419|LXL04_019419|OH1004|PROTEIN

MATIKVPEVVPSPTQDSETIHEALHGFIIDTKAVIKVLGHRNTTQRKIIRDTYRELYNQDLIDALHSKITFNFGRAVVLWTYDPSERDARLVNEALSSKKIDKNELQVIVEISCASSPHHLMAIRKCYCSLYKRSLEEDIIDNAPKSVRKILVGLVSAFRFDGEMVDMDLANDEASKLEETIKLKQLDQDVFVWILSTRNVFQLRATFESYQQKFGNHIFEDIKDSGNDLLVSFVKDVIRCIASPEKYFAEVIKVATDGW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019419`
TK1151 ID	TkA05G050500
OH-1004 ID	LXL04_019419
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.300
Protein coverage (%)	TK1151 98.473 / OH-1004 81.646 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019419

Location Chr04:30965107-30968835 (-)

Description Similar to ANN3: Annexin D3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g38760`	Annexin D3.	No verified direct reference in this release
`At5g12380`	Annexin D8.	No verified direct reference in this release
`At5g10230`	Annexin D7.	No verified direct reference in this release
`At5g65020`	May mediate regulated, targeted secretion of Golgi-derived vesicles during seedling development.	No verified direct reference in this release
`At5g10220`	Annexin D6.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019419 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009639 response to red or far red light Biological Process

GO:0009651 response to salt stress Biological Process

GO:0015774 polysaccharide transport Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0080022 primary root development Biological Process

GO:0110128 phloem sucrose unloading Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G38760

ath:AT5G10220

ath:AT5G10230

ath:AT5G12380

ath:AT5G65020

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.474

Rank 1 · LXL04_019419 · OH-1004

Cell membrane0.245

Rank 2 · LXL04_019419 · OH-1004

Nucleus0.211

Rank 3 · LXL04_019419 · OH-1004

Plastid0.095

Rank 4 · LXL04_019419 · OH-1004

Mitochondrion0.058

Rank 5 · LXL04_019419 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00191.26Annexin15-78 aa

PF00191.26Annexin88-154 aa

PF00191.26Annexin175-225 aa

PF00191.26Annexin248-313 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019419	`PF00191.26`	Annexin	15	78	1.4e-49	166.7
LXL04_019419	`PF00191.26`	Annexin	88	154	1.4e-49	166.7
LXL04_019419	`PF00191.26`	Annexin	175	225	1.4e-49	166.7
LXL04_019419	`PF00191.26`	Annexin	248	313	1.4e-49	166.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SE45`	Arabidopsis thaliana	Annexin D3	50.157%	Swiss-Prot	strong database homology
`Q94CK4`	Arabidopsis thaliana	Annexin D8	42.405%	Swiss-Prot	moderate database homology
`Q9LX07`	Arabidopsis thaliana	Annexin D7	41.139%	Swiss-Prot	moderate database homology
`Q9XEE2`	Arabidopsis thaliana	Annexin D2	40.694%	Swiss-Prot	moderate database homology
`Q9LX08`	Arabidopsis thaliana	Annexin D6	40.881%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card