LXL04_018961 | RubberDandelionOmics

Gene overview

LXL04_018961

Reference: OH-1004 Chr: Chr04 Coordinates: 20450724-20453205 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1476 bp · LXL04_018961|LXL04_018961|OH1004|cDNA

ATGATCTATAGGAGAGGATTCAAATTCGTCAAGAAGGTGTTGCCCGATGAATTCATTCTTAACCGGATGAGTAACCGGCTATCTAAAAGACCCGTTATACATCCGAGTCGGACTCCTCCGATCAAATTTGTTTTAGTCATCCTGAGTGACATAAACCACCGTAGGCTATTGCGAGGAGGCAATCAGCAGGGCAAAGCGGAGGCACTGAGAATGGTAGTTCGATGCAAGTTTTGGCTGGTAAAAAAGAAGAGATTTTGTGC...

CDS

Download CDS FASTA

1476 bp · LXL04_018961|LXL04_018961|OH1004|CDS

ATGATCTATAGGAGAGGATTCAAATTCGTCAAGAAGGTGTTGCCCGATGAATTCATTCTTAACCGGATGAGTAACCGGCTATCTAAAAGACCCGTTATACATCCGAGTCGGACTCCTCCGATCAAATTTGTTTTAGTCATCCTGAGTGACATAAACCACCGTAGGCTATTGCGAGGAGGCAATCAGCAGGGCAAAGCGGAGGCACTGAGAATGGTAGTTCGATGCAAGTTTTGGCTGGTAAAAAAGAAGAGATTTTGTGC...

Protein

Download Protein FASTA

491 aa · LXL04_018961|LXL04_018961|OH1004|PROTEIN

MIYRRGFKFVKKVLPDEFILNRMSNRLSKRPVIHPSRTPPIKFVLVILSDINHRRLLRGGNQQGKAEALRMVVRCKFWLVKKKRFCAIPPLPDSEFCGNHSTRPDDRWILCSIDPSHSVLESNLENHLRRCPLLKHNNSLSLQSFYQKGINGGDEEDEDVSSESKRMAVHSIAAPELIKLFRKIKSVHALICKNIQDSYNVPEACRMWIDRSVDWKTPFQEKHVIQQASILGNLEKLGALKSSSSSSVGEGEQLAVVEFG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018961`
TK1151 ID	TkA05G005520
OH-1004 ID	LXL04_018961
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.100
Protein coverage (%)	TK1151 100.000 / OH-1004 85.743 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018961

Location Chr04:20450724-20453205 (-)

Description Similar to TRM13: tRNA:m(4)X modification enzyme TRM13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0833200`	tRNA methylase that catalyzes 2'-O-methyladenosine (Am) nucleoside formation on tRNA(Gly)(GCC) in vitro.	The 2'-O-methyladenosine nucleoside modification gene OsTRM13 positively regulates salt stress tolerance in rice.2017 · DOI: 10.1093/jxb/erx061

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018961 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002128 tRNA nucleoside ribose methylation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0030488 tRNA methylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0008175 tRNA methyltransferase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0106050 tRNA 2'-O-methyltransferase activity Molecular Function

KEGG gene cross-reference

dosa:Os03g0833200

hsa:54482

kla:KLLA0_E07547g

mmu:229780

vpo:Kpol_1076p3

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.615

Rank 1 · LXL04_018961 · OH-1004

Cytoplasm0.334

Rank 2 · LXL04_018961 · OH-1004

Mitochondrion0.055

Rank 3 · LXL04_018961 · OH-1004

Cell membrane0.048

Rank 4 · LXL04_018961 · OH-1004

Plastid0.045

Rank 5 · LXL04_018961 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11722.14zf-TRM13_CCCH74-100 aa

PF05206.21TRM13225-489 aa

PF13679.13Methyltransf_32247-369 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018961	`PF11722.14`	zf-TRM13_CCCH	74	100	4.1e-13	49.4
LXL04_018961	`PF05206.21`	TRM13	225	489	3.2e-80	270.1
LXL04_018961	`PF13679.13`	Methyltransf_32	247	369	1.7e-08	35.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q10B19`	Oryza sativa subsp. japonica	tRNA:m(4)X modification enzyme TRM13	51.101%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card