LXL04_018888 | RubberDandelionOmics

Gene overview

LXL04_018888

Reference: OH-1004 Chr: Chr04 Coordinates: 19622917-19630403 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2844 bp · LXL04_018888|LXL04_018888|OH1004|cDNA

ATGGCGGCATCGTCGAGTTCTTCAGCTTTAGAGTCATCGTCGTCTACTTCGTCTTCGTCTTCGGATAATTTCAGGAATCTTCCTATCATGTCGCTCCGAAGCAAAATCGTCGAGAAGATAATGGAGAATCGCGTCACTCTGATCGTCGGTGAAACCGGCTGCGGGAAGAGCTCACAAGTTCCTCAGTTTTTACTCGAAGCAAACATTGAGCCAATAATATGTACACAACCAAGGAGGTTTGCTGTGGTGGCAGTTGCTAA...

CDS

Download CDS FASTA

2844 bp · LXL04_018888|LXL04_018888|OH1004|CDS

ATGGCGGCATCGTCGAGTTCTTCAGCTTTAGAGTCATCGTCGTCTACTTCGTCTTCGTCTTCGGATAATTTCAGGAATCTTCCTATCATGTCGCTCCGAAGCAAAATCGTCGAGAAGATAATGGAGAATCGCGTCACTCTGATCGTCGGTGAAACCGGCTGCGGGAAGAGCTCACAAGTTCCTCAGTTTTTACTCGAAGCAAACATTGAGCCAATAATATGTACACAACCAAGGAGGTTTGCTGTGGTGGCAGTTGCTAA...

Protein

Download Protein FASTA

947 aa · LXL04_018888|LXL04_018888|OH1004|PROTEIN

MAASSSSSALESSSSTSSSSSDNFRNLPIMSLRSKIVEKIMENRVTLIVGETGCGKSSQVPQFLLEANIEPIICTQPRRFAVVAVAKMVAQARNCTTGGEVGYHIGHSKVISSSSKIIFKTAGVLLEEMREKGMNALKYKVIILDEVHERSVESDLVLVCVKQFMIKNSGLRVVLMSATADISRYKDYFKDLGRGERVEVLGIPSSSQHTLYQRRVSYLEQVVDLLNMDSELPLSLKYCSGSTPSSEATMNDEVHKLIHN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018888`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018888

Location Chr04:19622917-19630403 (+)

Description Similar to At2g47680: DExH-box ATP-dependent RNA helicase DExH8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g47680`	DExH-box ATP-dependent RNA helicase DExH8.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0256800`	Zinc finger CCCH domain-containing protein 4.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018888 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001731 formation of translation preinitiation complex Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0030154 cell differentiation Biological Process

GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process

GO:0042255 ribosome assembly Biological Process

GO:0045948 positive regulation of translational initiation Biological Process

GO:0051321 meiotic cell cycle Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0016282 eukaryotic 43S preinitiation complex Cellular Component

GO:0022627 cytosolic small ribosomal subunit Cellular Component

KEGG gene cross-reference

aag:5577484

ath:AT2G47680

hsa:54505

mmu:218629

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.504

Rank 1 · LXL04_018888 · OH-1004

Nucleus0.476

Rank 2 · LXL04_018888 · OH-1004

Mitochondrion0.089

Rank 3 · LXL04_018888 · OH-1004

Peroxisome0.045

Rank 4 · LXL04_018888 · OH-1004

Cell membrane0.043

Rank 5 · LXL04_018888 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270.36DEAD34-185 aa

PF00271.38Helicase_C269-386 aa

PF00642.31zf-CCCH732-753 aa

PF18345.8zf_CCCH_4734-752 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018888	`PF00270.36`	DEAD	34	185	1.2e-08	35.6
LXL04_018888	`PF00271.38`	Helicase_C	269	386	1.6e-13	51.6
LXL04_018888	`PF00642.31`	zf-CCCH	732	753	4.9e-08	33.4
LXL04_018888	`PF18345.8`	zf_CCCH_4	734	752	3.1e-09	37.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O22243`	Arabidopsis thaliana	DExH-box ATP-dependent RNA helicase DExH8	57.082%	Swiss-Prot	strong database homology
`Q1EHT7`	Oryza sativa subsp. japonica	Zinc finger CCCH domain-containing protein 4	53.556%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card