LXL04_018790 | RubberDandelionOmics

Gene overview

LXL04_018790

Reference: OH-1004 Chr: Chr04 Coordinates: 18271295-18276208 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1707 bp · LXL04_018790|LXL04_018790|OH1004|cDNA

ATGGAGAATTATGAAATATTAGAGCAGATTGGAAAGGGCTCCTTTGCTTCTGCTTTACTTGTTAAGCATAAACGTGAAAAGAAAAAGTATGTATTGAAGAAAATTCGACTTGCAAGACAGTCTGATAGGACCCGTAAATCTGCACTCTTGGAGATGGACCTTATTTCCAAAGTGCAAAATCCTTTTATAGTCGAATACAAAGATTCATGGGTAGAAAAGGGTTGCTATGTGTGTATTATTATAGCCCATTGTGAAGGTGG...

CDS

Download CDS FASTA

1707 bp · LXL04_018790|LXL04_018790|OH1004|CDS

ATGGAGAATTATGAAATATTAGAGCAGATTGGAAAGGGCTCCTTTGCTTCTGCTTTACTTGTTAAGCATAAACGTGAAAAGAAAAAGTATGTATTGAAGAAAATTCGACTTGCAAGACAGTCTGATAGGACCCGTAAATCTGCACTCTTGGAGATGGACCTTATTTCCAAAGTGCAAAATCCTTTTATAGTCGAATACAAAGATTCATGGGTAGAAAAGGGTTGCTATGTGTGTATTATTATAGCCCATTGTGAAGGTGG...

Protein

Download Protein FASTA

568 aa · LXL04_018790|LXL04_018790|OH1004|PROTEIN

MENYEILEQIGKGSFASALLVKHKREKKKYVLKKIRLARQSDRTRKSALLEMDLISKVQNPFIVEYKDSWVEKGCYVCIIIAHCEGGDMTEAIKRANGTHFSEEKLCKWLVQLLVALDYLHVNHILHRDVKCSNIFLTRDQEIRLGDFGLAKMLTSDDLASSVVGTPSYMCPELLADIPYGSKSDIWSLGCCIYEMMAFKPAFKAFDMQALINKINKCIVAPLPTMYSGAFRGLVKSMLRKNPETRPNAADLLKHSHLQP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018790`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018790

Location Chr04:18271295-18276208 (-)

Description Similar to NEK2: Serine/threonine-protein kinase Nek2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g04810`	May be involved in plant development processes.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0604700`	May be involved in plant development processes.	No verified direct reference in this release
`UniProt: A2ZMH2`	May be involved in plant development processes.	No verified direct reference in this release
`Os03g0636800`	May be involved in plant development processes.	No verified direct reference in this release
`Os07g0176600`	May be involved in plant development processes (Probable).	Cytoplasmic male sterility-related protein kinase, OsNek3, is regulated downstream of mitochondrial protein phosphatase 2C, DCW11.2009 · DOI: 10.1093/pcp/pcp026

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018790 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005737 cytoplasm Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G04810

dosa:Os03g0636800

dosa:Os07g0176600

dosa:Os12g0604700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.707

Rank 1 · LXL04_018790 · OH-1004

Nucleus0.266

Rank 2 · LXL04_018790 · OH-1004

Cell membrane0.092

Rank 3 · LXL04_018790 · OH-1004

Golgi apparatus0.045

Rank 4 · LXL04_018790 · OH-1004

Lysosome / Vacuole0.042

Rank 5 · LXL04_018790 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase4-257 aa

PF07714.24PK_Tyr_Ser-Thr6-254 aa

PF14531.13Kinase-like89-246 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018790	`PF00069.32`	Pkinase	4	257	5.6e-62	210.2
LXL04_018790	`PF07714.24`	PK_Tyr_Ser-Thr	6	254	3.9e-36	125.4
LXL04_018790	`PF14531.13`	Kinase-like	89	246	6e-06	26.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CAU7`	Arabidopsis thaliana	Serine/threonine-protein kinase Nek2	54.173%	Swiss-Prot	strong database homology
`Q2QMH1`	Oryza sativa subsp. japonica	Serine/threonine-protein kinase Nek2	57.380%	Swiss-Prot	strong database homology
`A2ZMH2`	Oryza sativa subsp. indica	Serine/threonine-protein kinase Nek2	57.380%	Swiss-Prot	strong database homology
`Q10GB1`	Oryza sativa subsp. japonica	Serine/threonine-protein kinase Nek1	57.492%	Swiss-Prot	strong database homology
`Q6ZEZ5`	Oryza sativa subsp. japonica	Serine/threonine-protein kinase Nek3	54.125%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card