LXL04_018606 | RubberDandelionOmics

Gene overview

LXL04_018606

Reference: OH-1004 Chr: Chr04 Coordinates: 15555302-15559033 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2043 bp · LXL04_018606|LXL04_018606|OH1004|cDNA

ATGAGGCAGCTTCGCCAGAGGGAGATGGATCTCCTTGTCTTGTGTCCTATACGGGTGGGTGATGGTCTCACTACCCGGTTCTGGCAGGATAGGTGGGTGGGTGATCAACCTCTGATTGATGCCTTTCCTTGGGTTTTTGCTTTGGATATTTTTCAGCAAGTGACTGTTGGAGAGCAGGTTCAAATTGAGTGGAATCTAGATTTGTTATGTAGGAGACCAAGGGGTGAGGCTGAGCAGGTGCAGTGGGAGACTTTCATGGT...

CDS

Download CDS FASTA

2043 bp · LXL04_018606|LXL04_018606|OH1004|CDS

ATGAGGCAGCTTCGCCAGAGGGAGATGGATCTCCTTGTCTTGTGTCCTATACGGGTGGGTGATGGTCTCACTACCCGGTTCTGGCAGGATAGGTGGGTGGGTGATCAACCTCTGATTGATGCCTTTCCTTGGGTTTTTGCTTTGGATATTTTTCAGCAAGTGACTGTTGGAGAGCAGGTTCAAATTGAGTGGAATCTAGATTTGTTATGTAGGAGACCAAGGGGTGAGGCTGAGCAGGTGCAGTGGGAGACTTTCATGGT...

Protein

Download Protein FASTA

680 aa · LXL04_018606|LXL04_018606|OH1004|PROTEIN

MRQLRQREMDLLVLCPIRVGDGLTTRFWQDRWVGDQPLIDAFPWVFALDIFQQVTVGEQVQIEWNLDLLCRRPRGEAEQVQWETFMVQMSEVLLVGRRDRLGWLGDASDCFSVASACKWLDSRFLFVGGRITRWNSWIPIKLNLLLWRIRNGILPSRERLSVHGIMVNKSTGPFDALLCVGQFFPDASERLEELTEYIEGRKNIPLPTYFIGDYGAGAAKVLSAAAKESSNQGFKMDGLKIRDNLFWLKGSGKFTLHGLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018606`
TK1151 ID	TkA08G072050
OH-1004 ID	LXL04_018606
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	90.500
Protein coverage (%)	TK1151 95.784 / OH-1004 75.588 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018606

Location Chr04:15555302-15559033 (+)

Description Similar to At5g56900: Zinc finger CCCH domain-containing protein 64

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g56900`	Zinc finger CCCH domain-containing protein 64.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0364000`	Zinc finger CCCH domain-containing protein 59.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018606 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0005634 nucleus Cellular Component

GO:0071014 post-mRNA release spliceosomal complex Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0061632 RNA lariat debranching enzyme activator activity Molecular Function

KEGG gene cross-reference

ath:AT5G56900

dosa:Os09g0364000

mmu:72502

pon:100173021

xla:379111

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.653

Rank 1 · LXL04_018606 · OH-1004

Cytoplasm0.425

Rank 2 · LXL04_018606 · OH-1004

Mitochondrion0.047

Rank 3 · LXL04_018606 · OH-1004

Cell membrane0.042

Rank 4 · LXL04_018606 · OH-1004

Endoplasmic reticulum0.031

Rank 5 · LXL04_018606 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25585.2zf-CCCH_DUS3L392-418 aa

PF04677.21CwfJ_C_1457-574 aa

PF04676.20CwfJ_C_2597-677 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018606	`PF25585.2`	zf-CCCH_DUS3L	392	418	3.8e-09	37.1
LXL04_018606	`PF04677.21`	CwfJ_C_1	457	574	8.6e-36	123.2
LXL04_018606	`PF04676.20`	CwfJ_C_2	597	677	7.4e-20	72.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84WU9`	Arabidopsis thaliana	Zinc finger CCCH domain-containing protein 64	56.794%	Swiss-Prot	strong database homology
`Q69NK8`	Oryza sativa subsp. japonica	Zinc finger CCCH domain-containing protein 59	53.688%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card