RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_018506
Reference: OH-1004 Chr: Chr04 Coordinates: 13901871-13923761 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

5847 bp · LXL04_018506|LXL04_018506|OH1004|cDNA

ATGGAAGACTATTTGAAGGATTTTAACGTTCCGGCGAAGCATCCGTCGGAAGCAGCTCTGAAGAAATGGCGCAAGGCCGTCTCCCTCGTCAAAAACCACCGACGACGCTTCCGCCATGTCGCTGACCTCGAAAAACGATCTATTCACCAGAACCGACTGAGCAAAATCAAGGAAGACCTGCGTGTAACCTTCATCGCCATGAGAGCAGCAATGCGGTTCATGGACGCTGCCGCTCACCCTCAAAACCCTCGCGAACACCA...

CDS

Download CDS FASTA

5847 bp · LXL04_018506|LXL04_018506|OH1004|CDS

ATGGAAGACTATTTGAAGGATTTTAACGTTCCGGCGAAGCATCCGTCGGAAGCAGCTCTGAAGAAATGGCGCAAGGCCGTCTCCCTCGTCAAAAACCACCGACGACGCTTCCGCCATGTCGCTGACCTCGAAAAACGATCTATTCACCAGAACCGACTGAGCAAAATCAAGGAAGACCTGCGTGTAACCTTCATCGCCATGAGAGCAGCAATGCGGTTCATGGACGCTGCCGCTCACCCTCAAAACCCTCGCGAACACCA...

Protein

Download Protein FASTA

1948 aa · LXL04_018506|LXL04_018506|OH1004|PROTEIN

MEDYLKDFNVPAKHPSEAALKKWRKAVSLVKNHRRRFRHVADLEKRSIHQNRLSKIKEDLRVTFIAMRAAMRFMDAAAHPQNPREHHQPREIKLSEYTKNPDKLASMVRNYDMKTLRSLNGATGIAEAINVSIPEGVKSTDIPTRQETYGVNKYTEKPSKSFFMFIWDALHDLTLIILIVCAIVSIAVGLATEGFPNGIYDGLGILLSILLVVTVTAVSDYKQSLQFKDLDKEKKKISCHVTRDSGRKKVSIYDLVVGDV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_018506
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_018506
LocationChr04:13901871-13923761 (-)
DescriptionSimilar to ACA4: Calcium-transporting ATPase 4, plasma membrane-type
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g41560 This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol into small vacuoles. No verified direct reference in this release
At3g57330 This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell or into organelles. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os12g0136900 This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell, into the endoplasmic reticulum, or into organelles. No verified direct reference in this release
Os11g0140400 This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell, into the endoplasmic reticulum, or into organelles. No verified direct reference in this release
Os01g0939100 This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell, into the endoplasmic reticulum, or into organelles. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_018506 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0009624 response to nematode Biological Process
GO:0042742 defense response to bacterium Biological Process
GO:0043069 negative regulation of programmed cell death Biological Process
GO:0051480 regulation of cytosolic calcium ion concentration Biological Process
GO:0055081 monoatomic anion homeostasis Biological Process
GO:0000325 plant-type vacuole Cellular Component
GO:0005634 nucleus Cellular Component
GO:0005773 vacuole Cellular Component
GO:0005774 vacuolar membrane Cellular Component
GO:0005794 Golgi apparatus Cellular Component
GO:0005829 cytosol Cellular Component
GO:0005886 plasma membrane Cellular Component
KEGG gene cross-reference
ath:AT2G41560
ath:AT3G57330
dosa:Os12g0136900
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.527
Rank 1 · LXL04_018506 · OH-1004
Endoplasmic reticulum0.213
Rank 2 · LXL04_018506 · OH-1004
Cytoplasm0.138
Rank 3 · LXL04_018506 · OH-1004
Lysosome / Vacuole0.129
Rank 4 · LXL04_018506 · OH-1004
Golgi apparatus0.110
Rank 5 · LXL04_018506 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12515.14CaATP_NAI6-47 aa
PF00690.32Cation_ATPase_N122-185 aa
PF00122.26E1-E2_ATPase236-334 aa
PF00702.33Hydrolase451-755 aa
PF13246.13Cation_ATPase489-651 aa
PF08282.19Hydrolase_3728-783 aa
PF00689.27Cation_ATPase_C828-991 aa
PF00689.27Cation_ATPase_C985-1066 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_018506PF12515.14CaATP_NAI6476e-2587.2
LXL04_018506PF00690.32Cation_ATPase_N1221854.7e-2897.3
LXL04_018506PF00122.26E1-E2_ATPase2363341.4e-47160.4
LXL04_018506PF00702.33Hydrolase4517554.1e-29103.0
LXL04_018506PF13246.13Cation_ATPase4896519.5e-69231.5
LXL04_018506PF08282.19Hydrolase_37287834.5e-1143.7
LXL04_018506PF00689.27Cation_ATPase_C8289913.5e-50170.9
LXL04_018506PF00689.27Cation_ATPase_C98510663.5e-50170.9
LXL04_018506PF12515.14CaATP_NAI110211306e-2587.2
LXL04_018506PF00690.32Cation_ATPase_N124213064.7e-2897.3
LXL04_018506PF00122.26E1-E2_ATPase136014591.4e-47160.4
LXL04_018506PF13246.13Cation_ATPase161417769.5e-69231.5
LXL04_018506PF00702.33Hydrolase176118804.1e-29103.0
LXL04_018506PF08282.19Hydrolase_3185319134.5e-1143.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
O22218Arabidopsis thalianaCalcium-transporting ATPase 4, plasma membrane-type68.268%Swiss-Protmoderate database homology
Q9M2L4Arabidopsis thalianaPutative calcium-transporting ATPase 11, plasma membrane-type68.737%Swiss-Protmoderate database homology
Q2QY12Oryza sativa subsp. japonicaProbable calcium-transporting ATPase 9, plasma membrane-type65.703%Swiss-Protmoderate database homology
Q2RAS0Oryza sativa subsp. japonicaProbable calcium-transporting ATPase 8, plasma membrane-type64.905%Swiss-Protmoderate database homology
Q8RUN1Oryza sativa subsp. japonicaCalcium-transporting ATPase 1, plasma membrane-type63.483%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser