LXL04_018482 | RubberDandelionOmics

Gene overview

LXL04_018482

Reference: OH-1004 Chr: Chr04 Coordinates: 13588465-13604887 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

10428 bp · LXL04_018482|LXL04_018482|OH1004|cDNA

ATGGCTACGCCGTTCGTGTTTCCGCAAAACCTAATCGCCCTTGAAGAAGACTCCGGCGACGACGCCGGTCATCTATCCGTACAAAATCTCACCTCAATTTCATCTCTCCGGGCTTCAGATCTCGAAGAATTCGTCAAAGGCGTGTCATTTGATTTGTCCGACAAAGAGCTGTTTTGTGTCGAAGAACAAGAAATATTCGACCGGATTTACTCATTGGTTAAGTGTTTTGGTAACCTAACTCCTGGTTGTAAGCTGAATAT...

CDS

Download CDS FASTA

10428 bp · LXL04_018482|LXL04_018482|OH1004|CDS

ATGGCTACGCCGTTCGTGTTTCCGCAAAACCTAATCGCCCTTGAAGAAGACTCCGGCGACGACGCCGGTCATCTATCCGTACAAAATCTCACCTCAATTTCATCTCTCCGGGCTTCAGATCTCGAAGAATTCGTCAAAGGCGTGTCATTTGATTTGTCCGACAAAGAGCTGTTTTGTGTCGAAGAACAAGAAATATTCGACCGGATTTACTCATTGGTTAAGTGTTTTGGTAACCTAACTCCTGGTTGTAAGCTGAATAT...

Protein

Download Protein FASTA

3475 aa · LXL04_018482|LXL04_018482|OH1004|PROTEIN

MATPFVFPQNLIALEEDSGDDAGHLSVQNLTSISSLRASDLEEFVKGVSFDLSDKELFCVEEQEIFDRIYSLVKCFGNLTPGCKLNIVESLRSNFSVLLPNIDSLFRAPASPTSEERESDDGGRIFERISSHRNAFKIYTFFLIHVVLAQESTSASSNTTKVPPSNRKKQLSNSWNWEAQRGRILNLIANSLEINLSSLFGSSDPDENYLSFLVRDTLSMFENPTLLKDSDTKEALCRIIGTCATKYHYLAQSCASILHI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018482`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018482

Location Chr04:13588465-13604887 (-)

Description Similar to TY3B-I: Transposon Ty3-I Gag-Pol polyprotein (Saccharomyces cerevisiae (strain ATCC 204508 / S288c)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g57060`	Essential protein.	The Arabidopsis CAP-D proteins are required for correct chromatin organisation, growth and fertility.2013 · DOI: 10.1007/s00412-013-0424-y The condensin complexes play distinct roles to ensure normal chromosome morphogenesis during meiotic division in Arabidopsis.2014 · DOI: 10.1111/tpj.12628

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018482 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000278 mitotic cell cycle Biological Process

GO:0006310 DNA recombination Biological Process

GO:0006325 chromatin organization Biological Process

GO:0006508 proteolysis Biological Process

GO:0007076 mitotic chromosome condensation Biological Process

GO:0010032 meiotic chromosome condensation Biological Process

GO:0015074 DNA integration Biological Process

GO:0051301 cell division Biological Process

GO:0075523 viral translational frameshifting Biological Process

GO:0000779 condensed chromosome, centromeric region Cellular Component

GO:0000796 condensin complex Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT3G57060

sce:YGR109W-B

sce:YIL082W-A

spo:2542672

spo:2542797

spo:2543673

spo:3361218

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.505

Rank 1 · LXL04_018482 · OH-1004

Cytoplasm0.496

Rank 2 · LXL04_018482 · OH-1004

Cell membrane0.052

Rank 3 · LXL04_018482 · OH-1004

Mitochondrion0.051

Rank 4 · LXL04_018482 · OH-1004

Endoplasmic reticulum0.044

Rank 5 · LXL04_018482 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12922.14Cnd1_N83-251 aa

PF20168.5PDS5977-1207 aa

PF12717.14Cnd1978-1137 aa

PF00078.33RVT_11384-1625 aa

PF19259.5Ty3_capsid2051-2218 aa

PF03732.25PEG10_N-capsid2056-2127 aa

PF08284.17RVP_22371-2494 aa

PF30863.1PRO_PEG10-RTL12403-2488 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018482	`PF12922.14`	Cnd1_N	83	251	4.4e-34	118.4
LXL04_018482	`PF20168.5`	PDS5	977	1207	1.8e-06	26.8
LXL04_018482	`PF12717.14`	Cnd1	978	1137	1e-51	175.9
LXL04_018482	`PF00078.33`	RVT_1	1384	1625	1.8e-72	244.1
LXL04_018482	`PF19259.5`	Ty3_capsid	2051	2218	1.1e-09	38.7
LXL04_018482	`PF03732.25`	PEG10_N-capsid	2056	2127	6.9e-07	30.2
LXL04_018482	`PF08284.17`	RVP_2	2371	2494	3.3e-24	85.9
LXL04_018482	`PF30863.1`	PRO_PEG10-RTL1	2403	2488	1.3e-08	35.9
LXL04_018482	`PF00078.33`	RVT_1	2596	2755	1.8e-72	244.1
LXL04_018482	`PF17919.8`	RT_RNaseH_2	2819	2913	5.4e-29	100.9
LXL04_018482	`PF17917.8`	RT_RNaseH	2847	2943	8.4e-33	113.4
LXL04_018482	`PF17921.8`	Integrase_H2C2	3034	3087	2.3e-16	60.4
LXL04_018482	`PF00665.33`	rve	3112	3203	3.6e-07	31.1
LXL04_018482	`PF31073.1`	DUF8803	3327	3394	3.6e-07	30.6
LXL04_018482	`PF24626.2`	SH3_Tf2-1	3330	3394	2.9e-27	95.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A0A1I9LM04`	Arabidopsis thaliana	Condensin-1 complex subunit CAP-D2	68.078%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card