LXL04_018478 | RubberDandelionOmics

Gene overview

LXL04_018478

Reference: OH-1004 Chr: Chr04 Coordinates: 13568411-13569741 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

912 bp · LXL04_018478|LXL04_018478|OH1004|cDNA

ATGAGCGAGACACCCGATCCCATATCTTCTTCTGTCAACGAATTATCAAAAACTAGTAGCGGATCTTTCGATGCGAACCGAATAGGGGAAGTGAAATCCTGGCTGGCTTCCCAATTCGACGCGGCTGGGAAAGATCATGTCCCTGATTTCGATTATACCCCTCGTAGCGTTGCGCATCTACACAATCTGGCCACAATTTCTCAAGCCAAAACGCAAGCTGCCACCATAATCGCCAATGATTTTCGACTTAAAGCCTCCGA...

CDS

Download CDS FASTA

912 bp · LXL04_018478|LXL04_018478|OH1004|CDS

ATGAGCGAGACACCCGATCCCATATCTTCTTCTGTCAACGAATTATCAAAAACTAGTAGCGGATCTTTCGATGCGAACCGAATAGGGGAAGTGAAATCCTGGCTGGCTTCCCAATTCGACGCGGCTGGGAAAGATCATGTCCCTGATTTCGATTATACCCCTCGTAGCGTTGCGCATCTACACAATCTGGCCACAATTTCTCAAGCCAAAACGCAAGCTGCCACCATAATCGCCAATGATTTTCGACTTAAAGCCTCCGA...

Protein

Download Protein FASTA

303 aa · LXL04_018478|LXL04_018478|OH1004|PROTEIN

MSETPDPISSSVNELSKTSSGSFDANRIGEVKSWLASQFDAAGKDHVPDFDYTPRSVAHLHNLATISQAKTQAATIIANDFRLKASEYHSQAARIREILENIGLAQEGLPANVVASSQVLANVANLLNIRDTELSSFLVAMGDVSLRKTGVEDKRAKVQKESKILLDYTRKAIARLTYLKRTLAQLEDDVAPCEAQMESWNTNLSIMISKERQYLQQYSNYKAMLNRVGYTPEISHGMLVEMAEHRKDLDKKTKPILDTL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018478`
TK1151 ID	TkA08G063530
OH-1004 ID	LXL04_018478
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018478

Location Chr04:13568411-13569741 (+)

Description Similar to AUG1: AUGMIN subunit 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g41350`	Involved in microtubules reorganization during spindle and phragmoplast development.	Characterization of the Arabidopsis augmin complex uncovers its critical function in the assembly of the acentrosomal spindle and phragmoplast microtubule arrays.2012 · DOI: 10.1105/tpc.112.096610

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018478 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007098 centrosome cycle Biological Process

GO:0010968 regulation of microtubule nucleation Biological Process

GO:0051225 spindle assembly Biological Process

GO:0051301 cell division Biological Process

GO:0000922 spindle pole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005813 centrosome Cellular Component

GO:0005819 spindle Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005874 microtubule Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0070652 HAUS complex Cellular Component

KEGG gene cross-reference

ath:AT2G41350

bta:528378

hsa:115106

mmu:225745

rno:192228

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.524

Rank 1 · LXL04_018478 · OH-1004

Cytoplasm0.466

Rank 2 · LXL04_018478 · OH-1004

Cell membrane0.035

Rank 3 · LXL04_018478 · OH-1004

Mitochondrion0.033

Rank 4 · LXL04_018478 · OH-1004

Lysosome / Vacuole0.033

Rank 5 · LXL04_018478 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25762.2HAUS130-268 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018478	`PF25762.2`	HAUS1	30	268	8.9e-76	255.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IK01`	Arabidopsis thaliana	AUGMIN subunit 1	76.923%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card