LXL04_018443 | RubberDandelionOmics

Gene overview

LXL04_018443

Reference: OH-1004 Chr: Chr04 Coordinates: 13034167-13035924 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1758 bp · LXL04_018443|LXL04_018443|OH1004|cDNA

ATGCTATCAGACTACCATTCCCCTTCCATTCTCAAACAATGCATCGCCATCTTGCATTCACGCGCCACTTCAATCCCCAAACTCAAACAAATCCATGCTTTTTCAATCAAGCATGGCGTCCCTCTCAACAACCCAGACATGGGGAAACATCTTCTCTTCACTCTCGTCTCCCTCGCCGCACCTATGCCATACGCCCACGAAATCTTCAAGCAACTCCACAACCCTAACATTTTCACTTGGAACACGATGATTAGAGGCTA...

CDS

Download CDS FASTA

1758 bp · LXL04_018443|LXL04_018443|OH1004|CDS

ATGCTATCAGACTACCATTCCCCTTCCATTCTCAAACAATGCATCGCCATCTTGCATTCACGCGCCACTTCAATCCCCAAACTCAAACAAATCCATGCTTTTTCAATCAAGCATGGCGTCCCTCTCAACAACCCAGACATGGGGAAACATCTTCTCTTCACTCTCGTCTCCCTCGCCGCACCTATGCCATACGCCCACGAAATCTTCAAGCAACTCCACAACCCTAACATTTTCACTTGGAACACGATGATTAGAGGCTA...

Protein

Download Protein FASTA

585 aa · LXL04_018443|LXL04_018443|OH1004|PROTEIN

MLSDYHSPSILKQCIAILHSRATSIPKLKQIHAFSIKHGVPLNNPDMGKHLLFTLVSLAAPMPYAHEIFKQLHNPNIFTWNTMIRGYAESESPKPAMDVHRNMRLSAVEPDTHTYPFLLKAIAKLISVKEGEKVHSIATKNGLGSLVFVQNGLVHMYAVCGRAESAHKLFEEMSDKNLVTWNSVINGYVLNGRPNETLTLYRDMIHEQVEPDGFTLVSLLTACAELGALALGKRVHVYMTKVGLSENPHAANALLDLYSK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018443`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018443

Location Chr04:13034167-13035924 (+)

Description Similar to PCMP-H28: Pentatricopeptide repeat-containing protein At4g21065

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g21065`	Pentatricopeptide repeat-containing protein At4g21065.	No verified direct reference in this release
`At2g01510`	Pentatricopeptide repeat-containing protein At2g01510, mitochondrial.	No verified direct reference in this release
`At5g48910`	Pentatricopeptide repeat-containing protein At5g48910.	No verified direct reference in this release
`At1g59720`	Involved in multiple sites RNA editing events in chloroplasts.	Pentatricopeptide repeat proteins with the DYW motif have distinct molecular functions in RNA editing and RNA cleavage in Arabidopsis chloroplasts.2009 · DOI: 10.1105/tpc.108.064667
`At1g74630`	Pentatricopeptide repeat-containing protein At1g74630.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018443 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0009451 RNA modification Biological Process

GO:0016556 mRNA modification Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0004519 endonuclease activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G59720

ath:AT1G74630

ath:AT2G01510

ath:AT4G21065

ath:AT5G48910

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.670

Rank 1 · LXL04_018443 · OH-1004

Plastid0.187

Rank 2 · LXL04_018443 · OH-1004

Nucleus0.053

Rank 3 · LXL04_018443 · OH-1004

Cytoplasm0.033

Rank 4 · LXL04_018443 · OH-1004

Cell membrane0.006

Rank 5 · LXL04_018443 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13041.13PPR_275-124 aa

PF13812.13PPR_375-123 aa

PF13041.13PPR_2177-224 aa

PF01535.27PPR179-207 aa

PF13041.13PPR_2250-277 aa

PF01535.27PPR252-277 aa

PF13041.13PPR_2278-325 aa

PF20431.5E_motif396-457 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018443	`PF13041.13`	PPR_2	75	124	1.5e-44	150.6
LXL04_018443	`PF13812.13`	PPR_3	75	123	1.7e-20	73.5
LXL04_018443	`PF13041.13`	PPR_2	177	224	1.5e-44	150.6
LXL04_018443	`PF01535.27`	PPR	179	207	2.4e-39	131.5
LXL04_018443	`PF13041.13`	PPR_2	250	277	1.5e-44	150.6
LXL04_018443	`PF01535.27`	PPR	252	277	2.4e-39	131.5
LXL04_018443	`PF13041.13`	PPR_2	278	325	1.5e-44	150.6
LXL04_018443	`PF20431.5`	E_motif	396	457	1.9e-19	70.4
LXL04_018443	`PF20430.4`	Eplus_motif	462	487	5.3e-06	26.8
LXL04_018443	`PF14432.13`	DYW_deaminase	493	585	3e-41	139.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A8MQA3`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At4g21065	62.027%	Swiss-Prot	strong database homology
`Q9ZVF4`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At2g01510, mitochondrial	43.005%	Swiss-Prot	moderate database homology
`Q9FI80`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At5g48910	39.869%	Swiss-Prot	moderate database homology
`Q0WQW5`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g59720, chloroplastic/mitochondrial	41.821%	Swiss-Prot	moderate database homology
`Q9CA54`	Arabidopsis thaliana	Pentatricopeptide repeat-containing protein At1g74630	38.906%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card