Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1776 bp · LXL04_018382|LXL04_018382|OH1004|cDNA
ATGCTGAGCGTGCTGAGATTGCACCTCCCGTCCGATATTCCGATTGTGGGTTGCGAGGTTTCGCCCTACGTGCTCATCCGCTGTCCCGACAAGACTGTCTCCACCGATGATGTCCCCGAGTCTTCCCCAATTGACGGCCATTTTCTGAGATACAAGTGGTATCGCATCCAGAGTGACAAAAAAGTCGCGATCTGTAGTGTACATCCATCCGAACAAGCCACTTTACAGTGTTTAGGTTGCGTGAAAGCCAAAATCCCCGT...
1776 bp · LXL04_018382|LXL04_018382|OH1004|CDS
ATGCTGAGCGTGCTGAGATTGCACCTCCCGTCCGATATTCCGATTGTGGGTTGCGAGGTTTCGCCCTACGTGCTCATCCGCTGTCCCGACAAGACTGTCTCCACCGATGATGTCCCCGAGTCTTCCCCAATTGACGGCCATTTTCTGAGATACAAGTGGTATCGCATCCAGAGTGACAAAAAAGTCGCGATCTGTAGTGTACATCCATCCGAACAAGCCACTTTACAGTGTTTAGGTTGCGTGAAAGCCAAAATCCCCGT...
Protein
Download Protein FASTA591 aa · LXL04_018382|LXL04_018382|OH1004|PROTEIN
MLSVLRLHLPSDIPIVGCEVSPYVLIRCPDKTVSTDDVPESSPIDGHFLRYKWYRIQSDKKVAICSVHPSEQATLQCLGCVKAKIPVTKSYHCTPKCFSDAWQHHRVLHERAASAINENGNEEEDIYGRFNNTTSGVTNTNGTTVPLPLYPATITQRNGGETWFEVGRSKTYTPTADDIGHVLKFECVVIDSETKSPVGQGNTILTSRVIPAPSPSPRRLISVIDGNGNGTGHLDSSSGTFTVLSYNILCDSYATSDIYG...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_018382 |
|---|---|
| TK1151 ID | TkA08G057960 |
| OH-1004 ID | LXL04_018382 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 99.700 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_018382 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr04:12304566-12307073 (+) | |||||||||
| Description | Similar to CCR4-1: Carbon catabolite repressor protein 4 homolog 1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000076 DNA replication checkpoint signaling Biological Process GO:0000289 nuclear-transcribed mRNA poly(A) tail shortening Biological Process GO:0005986 sucrose biosynthetic process Biological Process GO:0006260 DNA replication Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006368 transcription elongation by RNA polymerase II Biological Process GO:0006397 mRNA processing Biological Process GO:0006417 regulation of translation Biological Process GO:0007089 traversing start control point of mitotic cell cycle Biological Process GO:0010629 negative regulation of gene expression Biological Process GO:0019252 starch biosynthetic process Biological Process GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT3G58560 ath:AT3G58580 dre:553665 spo:2538913 uma:UMAG_10379 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF15801.12zf-C6H272-110 aaPF03372.30Exo_endo_phos244-576 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_018382 | PF15801.12 | zf-C6H2 | 72 | 110 | 3.8e-06 | 27.6 |
| LXL04_018382 | PF03372.30 | Exo_endo_phos | 244 | 576 | 8.6e-26 | 91.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.