LXL04_018282 | RubberDandelionOmics

Gene overview

LXL04_018282

Reference: OH-1004 Chr: Chr04 Coordinates: 10268548-10271731 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1245 bp · LXL04_018282|LXL04_018282|OH1004|cDNA

ATGGGCGTTGTTAAGGgCCCAAAGCCCCCAAATCTACTTCGCGTTTCCACTGAATTAGTTCACATACAAATTTATAGAAGATTCTCAGTAAACGTCTCGAACGCCATGGATGTCTCCGGTGAAGCTCGTAATAACTGCAACTTCCAGATTCCGCATTCTTCTCTTACTGTTGACCACACACTTCCTGTTCCGGAAATGAAACCTAGCCTCGTAAAGCTTTGCAAGGACCTGTTCAAGAAATGGTCAAATTTAGATGAATC...

CDS

Download CDS FASTA

1245 bp · LXL04_018282|LXL04_018282|OH1004|CDS

ATGGGCGTTGTTAAGGGCCCAAAGCCCCCAAATCTACTTCGCGTTTCCACTGAATTAGTTCACATACAAATTTATAGAAGATTCTCAGTAAACGTCTCGAACGCCATGGATGTCTCCGGTGAAGCTCGTAATAACTGCAACTTCCAGATTCCGCATTCTTCTCTTACTGTTGACCACACACTTCCTGTTCCGGAAATGAAACCTAGCCTCGTAAAGCTTTGCAAGGACCTGTTCAAGAAATGGTCAAATTTAGATGAATC...

Protein

Download Protein FASTA

414 aa · LXL04_018282|LXL04_018282|OH1004|PROTEIN

MGVVKGPKPPNLLRVSTELVHIQIYRRFSVNVSNAMDVSGEARNNCNFQIPHSSLTVDHTLPVPEMKPSLVKLCKDLFKKWSNLDESHFSAQRVAGGITNLLLKVSVEEQNGNTVHVTVRLYGPNTDYVINRERELQAIHYLSSAGFGAKLLGVFGNGMVQSFIHARTLEPLDLRKPKLAAEIAKQLNRFHQVDIPGSKEPQLWNDISKFFERGAVNSNILLFISSNLIFDDNEKQKRYNTISFKEVHTEISKLKELTGH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018282`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018282

Location Chr04:10268548-10271731 (-)

Description Similar to EMB1187: Probable ethanolamine kinase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g26830`	Involved in phospholipid biosynthesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018282 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006646 phosphatidylethanolamine biosynthetic process Biological Process

GO:0008654 phospholipid biosynthetic process Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0016310 phosphorylation Biological Process

GO:0035264 multicellular organism growth Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004305 ethanolamine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT2G26830

ddi:DDB_G0274955

hsa:55224

mmu:214253

rno:360843

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.643

Rank 1 · LXL04_018282 · OH-1004

Nucleus0.346

Rank 2 · LXL04_018282 · OH-1004

Mitochondrion0.130

Rank 3 · LXL04_018282 · OH-1004

Cell membrane0.098

Rank 4 · LXL04_018282 · OH-1004

Endoplasmic reticulum0.079

Rank 5 · LXL04_018282 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01633.27Choline_kinase92-393 aa

PF01636.30APH92-309 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018282	`PF01633.27`	Choline_kinase	92	393	2.6e-95	319.9
LXL04_018282	`PF01636.30`	APH	92	309	1.7e-12	48.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81024`	Arabidopsis thaliana	Probable ethanolamine kinase	68.320%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card