LXL04_018280 | RubberDandelionOmics

Gene overview

LXL04_018280

Reference: OH-1004 Chr: Chr04 Coordinates: 10259333-10262395 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2037 bp · LXL04_018280|LXL04_018280|OH1004|cDNA

ATGGATGGAAACCTAGGTATCTCTCTCGACAAGCTCCCAGTCAAGCGTTTGGAAATCATTGAAGAAAATGGAGCTGAAAAATTCCCTCCCGATTTGAGTTACGATGATAACAGAGTGAATCAAATTCGACGAATAGACTTTGCGTGGGCAGTTGAAAGAGAAGATCCAGccaaaaaacaaaagaaaggCGAAACCGCTGCCAGTTCTTCCAAAGATACAACATCTTCACCACCATGGCCATGGCAGAACATGGTAGAAAA...

CDS

Download CDS FASTA

2037 bp · LXL04_018280|LXL04_018280|OH1004|CDS

ATGGATGGAAACCTAGGTATCTCTCTCGACAAGCTCCCAGTCAAGCGTTTGGAAATCATTGAAGAAAATGGAGCTGAAAAATTCCCTCCCGATTTGAGTTACGATGATAACAGAGTGAATCAAATTCGACGAATAGACTTTGCGTGGGCAGTTGAAAGAGAAGATCCAGCCAAAAAACAAAAGAAAGGCGAAACCGCTGCCAGTTCTTCCAAAGATACAACATCTTCACCACCATGGCCATGGCAGAACATGGTAGAAAA...

Protein

Download Protein FASTA

678 aa · LXL04_018280|LXL04_018280|OH1004|PROTEIN

MDGNLGISLDKLPVKRLEIIEENGAEKFPPDLSYDDNRVNQIRRIDFAWAVEREDPAKKQKKGETAASSSKDTTSSPPWPWQNMVENLKLAHQELSVIIDLINTVEVNDAVTVAGMTRPKQLPNELLSDLAVSTATKLQCFRQLGKYFKQSAKALEKQVAREARFYGALIRLQQNWKVKRHRMAASAAGNEGFYIDLFDNTLYDPTAMFRQSSMSTVRVEHDSNGMLALNFPSKACHVLQFGFVTGNSDNISKKPKRYLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018280`
TK1151 ID	TkA08G016610
OH-1004 ID	LXL04_018280
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018280

Location Chr04:10259333-10262395 (+)

Description Similar to MED17: Mediator of RNA polymerase II transcription subunit 17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g20170`	Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018280 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006974 DNA damage response Biological Process

GO:0009640 photomorphogenesis Biological Process

GO:0035196 miRNA processing Biological Process

GO:0005634 nucleus Cellular Component

GO:0016592 mediator complex Cellular Component

GO:0070847 core mediator complex Cellular Component

GO:0003712 transcription coregulator activity Molecular Function

KEGG gene cross-reference

ath:AT5G20170

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.934

Rank 1 · LXL04_018280 · OH-1004

Cytoplasm0.144

Rank 2 · LXL04_018280 · OH-1004

Mitochondrion0.023

Rank 3 · LXL04_018280 · OH-1004

Cell membrane0.020

Rank 4 · LXL04_018280 · OH-1004

Golgi apparatus0.011

Rank 5 · LXL04_018280 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10156.15Med17118-409 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018280	`PF10156.15`	Med17	118	409	3.2e-08	33.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K460`	Arabidopsis thaliana	Mediator of RNA polymerase II transcription subunit 17	51.324%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card