LXL04_018213 | RubberDandelionOmics

Gene overview

LXL04_018213

Reference: OH-1004 Chr: Chr04 Coordinates: 8736634-8738357 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

624 bp · LXL04_018213|LXL04_018213|OH1004|cDNA

ATGCAGATGGCTGGAGCAACTAATACTTATATGTTCATGCAAGATAAACCAAAGGCGGTTGAGATACTAGTAAATGATTTGAAAGTGTTCTCAACATTCAATGAAGACTTATATAAGGAAATTACACAACTTTTGACACTTTCAAATTTTAGGGACAATGAGCAGCTATCTAAATATGGTGATACTAAAATAGAAGTCAACAACAGTCTTTACTTTAGGCAGCTATGGGTATGGATACATGCTGCAGCATTAACTGAAGG...

CDS

Download CDS FASTA

624 bp · LXL04_018213|LXL04_018213|OH1004|CDS

ATGCAGATGGCTGGAGCAACTAATACTTATATGTTCATGCAAGATAAACCAAAGGCGGTTGAGATACTAGTAAATGATTTGAAAGTGTTCTCAACATTCAATGAAGACTTATATAAGGAAATTACACAACTTTTGACACTTTCAAATTTTAGGGACAATGAGCAGCTATCTAAATATGGTGATACTAAAATAGAAGTCAACAACAGTCTTTACTTTAGGCAGCTATGGGTATGGATACATGCTGCAGCATTAACTGAAGG...

Protein

Download Protein FASTA

207 aa · LXL04_018213|LXL04_018213|OH1004|PROTEIN

MQMAGATNTYMFMQDKPKAVEILVNDLKVFSTFNEDLYKEITQLLTLSNFRDNEQLSKYGDTKIEVNNSLYFRQLWVWIHAAALTEGYNALKSACESQVAFSSCPPCFMESRSRITKIWLAQHEQFVNTQLRNENEKLQANFLNYGVIGEEEKELGEEVEDQICLDDINDVYFIYCIYQTSTLNCVFVLMIVYFLYCEKVNLMFDLF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018213`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018213

Location Chr04:8736634-8738357 (-)

Description Similar to TPR1: Topless-related protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g80490`	Transcriptional corepressor.	Arabidopsis resistance protein SNC1 activates immune responses through association with a transcriptional corepressor.2010 · DOI: 10.1073/pnas.1002828107
`At1g15750`	Transcriptional corepressor.	No verified direct reference in this release
`At5g27030`	Transcriptional corepressor.	No verified direct reference in this release
`At3g16830`	Transcriptional corepressor.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0254100`	Probable downstream regulator of strigolactones signaling.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018213 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009733 response to auxin Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0010051 xylem and phloem pattern formation Biological Process

GO:0010072 primary shoot apical meristem specification Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0062208 positive regulation of pattern recognition receptor signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0042802 identical protein binding Molecular Function

KEGG gene cross-reference

ath:AT1G15750

ath:AT1G80490

ath:AT3G16830

ath:AT5G27030

dosa:Os01g0254100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.406

Rank 1 · LXL04_018213 · OH-1004

Nucleus0.358

Rank 2 · LXL04_018213 · OH-1004

Mitochondrion0.176

Rank 3 · LXL04_018213 · OH-1004

Endoplasmic reticulum0.071

Rank 4 · LXL04_018213 · OH-1004

Cell membrane0.061

Rank 5 · LXL04_018213 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21889.2TPR1-like_2nd14-68 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018213	`PF21889.2`	TPR1-like_2nd	14	68	4e-19	69.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WV90`	Arabidopsis thaliana	Topless-related protein 1	84.000%	Swiss-Prot	weak database homology
`Q94AI7`	Arabidopsis thaliana	Protein TOPLESS	84.000%	Swiss-Prot	weak database homology
`Q84JM4`	Arabidopsis thaliana	Topless-related protein 3	86.000%	Swiss-Prot	weak database homology
`Q9LRZ0`	Arabidopsis thaliana	Topless-related protein 2	83.673%	Swiss-Prot	weak database homology
`Q5NBT9`	Oryza sativa subsp. japonica	Protein TPR1	84.000%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card