LXL04_018187 | RubberDandelionOmics

Gene overview

LXL04_018187

Reference: OH-1004 Chr: Chr04 Coordinates: 8210340-8211324 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

582 bp · LXL04_018187|LXL04_018187|OH1004|cDNA

ATGGCTGGTATGCTACCTGGAGTCGAAAGCGCTAGGAGGAGGAGAATACATGGGAGTAGTGGCTGGTGCGATTCGTCGTCTATCGTCGGTTCTGGTTTTGGATCCGCGAGGATTAGAGTTTCTCATGATACCCATTTCACGACAACTTCATTCCTGCAAAGAAGTATGGTGAATCAAACTGAAGAAGATGAGAAGTTAGGAGGGGTCGCTAGAGAAGCCAAAGAAAGATTGGATGGGAGGCTAAGAGGCCATCTAAAAAA...

CDS

Download CDS FASTA

582 bp · LXL04_018187|LXL04_018187|OH1004|CDS

ATGGCTGGTATGCTACCTGGAGTCGAAAGCGCTAGGAGGAGGAGAATACATGGGAGTAGTGGCTGGTGCGATTCGTCGTCTATCGTCGGTTCTGGTTTTGGATCCGCGAGGATTAGAGTTTCTCATGATACCCATTTCACGACAACTTCATTCCTGCAAAGAAGTATGGTGAATCAAACTGAAGAAGATGAGAAGTTAGGAGGGGTCGCTAGAGAAGCCAAAGAAAGATTGGATGGGAGGCTAAGAGGCCATCTAAAAAA...

Protein

Download Protein FASTA

193 aa · LXL04_018187|LXL04_018187|OH1004|PROTEIN

MAGMLPGVESARRRRIHGSSGWCDSSSIVGSGFGSARIRVSHDTHFTTTSFLQRSMVNQTEEDEKLGGVAREAKERLDGRLRGHLKKDITRKKSQERSGSVGRTTTPMVVENLQVEVFGLKKSGLRRLSWGRTGLSWKSMNQEECAICLDHLKANEKVIHLPCTHRFHSDCLVPWLERNSHCPCCRTIVIGSN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018187`
TK1151 ID	TkA08G021660
OH-1004 ID	LXL04_018187
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 71.503 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018187

Location Chr04:8210340-8211324 (-)

Description Similar to rnf126-b: E3 ubiquitin-protein ligase RNF126-B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g19950`	E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018187 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0006513 protein monoubiquitination Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0035519 protein K29-linked ubiquitination Biological Process

GO:0042059 negative regulation of epidermal growth factor receptor signaling pathway Biological Process

GO:0042127 regulation of cell population proliferation Biological Process

GO:0042147 retrograde transport, endosome to Golgi Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0043162 ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway Biological Process

GO:0044314 protein K27-linked ubiquitination Biological Process

GO:0070534 protein K63-linked ubiquitination Biological Process

GO:0070936 protein K48-linked ubiquitination Biological Process

KEGG gene cross-reference

ath:AT3G19950

bta:507447

hsa:55658

xla:432033

xtr:448402

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.443

Rank 1 · LXL04_018187 · OH-1004

Cytoplasm0.411

Rank 2 · LXL04_018187 · OH-1004

Cell membrane0.196

Rank 3 · LXL04_018187 · OH-1004

Endoplasmic reticulum0.056

Rank 4 · LXL04_018187 · OH-1004

Mitochondrion0.054

Rank 5 · LXL04_018187 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12678.14zf-rbx1142-186 aa

PF13639.13zf-RING_2144-186 aa

PF17123.12zf-RING_11144-172 aa

PF13923.13zf-C3HC4_2144-185 aa

PF00097.32zf-C3HC4145-185 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018187	`PF12678.14`	zf-rbx1	142	186	7.9e-06	26.7
LXL04_018187	`PF13639.13`	zf-RING_2	144	186	3.8e-13	50.2
LXL04_018187	`PF17123.12`	zf-RING_11	144	172	3e-10	40.3
LXL04_018187	`PF13923.13`	zf-C3HC4_2	144	185	2.7e-09	37.4
LXL04_018187	`PF00097.32`	zf-C3HC4	145	185	9.5e-07	29.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LPN7`	Arabidopsis thaliana	E3 ubiquitin-protein ligase RING1-like	51.064%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card