LXL04_017936 | RubberDandelionOmics

Gene overview

LXL04_017936

Reference: OH-1004 Chr: Chr04 Coordinates: 3951681-3953713 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1188 bp · LXL04_017936|LXL04_017936|OH1004|cDNA

ATGGACTGGAACTTGAATACTTCTTCAGAATGGGACTTGGACAACATAGCCATGTACAGCAGCAAGGAGATCGGAGTTCccaaaaacattcaattttctaGCCATGAAACCCAAGAAAATGCGCAATTTTCCAAAGATACAATCAAGACTTTTACAGGGTTTGGTGATTTACCAAAAGATTTCCTGGAGAAAGATGAACAGTCTTCTTGGATAGGGGAGAATGTAAGCTGCTGTCTCTCTACCATTGTCGAAGAAGCATC...

CDS

Download CDS FASTA

1188 bp · LXL04_017936|LXL04_017936|OH1004|CDS

ATGGACTGGAACTTGAATACTTCTTCAGAATGGGACTTGGACAACATAGCCATGTACAGCAGCAAGGAGATCGGAGTTCCCAAAAACATTCAATTTTCTAGCCATGAAACCCAAGAAAATGCGCAATTTTCCAAAGATACAATCAAGACTTTTACAGGGTTTGGTGATTTACCAAAAGATTTCCTGGAGAAAGATGAACAGTCTTCTTGGATAGGGGAGAATGTAAGCTGCTGTCTCTCTACCATTGTCGAAGAAGCATC...

Protein

Download Protein FASTA

395 aa · LXL04_017936|LXL04_017936|OH1004|PROTEIN

MDWNLNTSSEWDLDNIAMYSSKEIGVPKNIQFSSHETQENAQFSKDTIKTFTGFGDLPKDFLEKDEQSSWIGENVSCCLSTIVEEASVLSGEAMIGLKLGRHASSSSTTSRSDHDHDHSKTATTSSSVSLFPTSSPMIKRSRASYLSSQSPRCQVEGCNLDLSSSKDYHRRHKICANHSKSPKVVVAGMERRFCQQCSRKVTFHDLSEFDDRKRSCRRRLSAHNARRRRPQSEEIQFSSSRLSSSMCDRRPRMNFVLNRA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017936`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017936

Location Chr04:3951681-3953713 (-)

Description Similar to SPL12: Squamosa promoter-binding-like protein 12

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g27360`	Trans-acting factor that binds specifically to the consensus nucleotide sequence 5'-TNCGTACAA-3'.	No verified direct reference in this release
`At1g27370`	Trans-acting factor that binds specifically to the consensus nucleotide sequence 5'-TNCGTACAA-3'.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2YGR5`	Trans-acting factor that binds specifically to the consensus nucleotide sequence 5'-TNCGTACAA-3' (By similarity).	No verified direct reference in this release
`Os06g0703500`	Trans-acting factor that binds specifically to the consensus nucleotide sequence 5'-TNCGTACAA-3' (By similarity).	No verified direct reference in this release
`Os02g0139400`	Trans-acting factor that binds specifically to the consensus nucleotide sequence 5'-TNCGTACAA-3' (By similarity).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017936 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0010262 somatic embryogenesis Biological Process

GO:0010358 leaf shaping Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0048510 regulation of timing of transition from vegetative to reproductive phase Biological Process

GO:0090356 negative regulation of auxin metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0001216 DNA-binding transcription activator activity Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT1G27360

ath:AT1G27370

dosa:Os06g0703500

osa:4341986

osa:9270639

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.931

Rank 1 · LXL04_017936 · OH-1004

Cytoplasm0.151

Rank 2 · LXL04_017936 · OH-1004

Cell membrane0.033

Rank 3 · LXL04_017936 · OH-1004

Endoplasmic reticulum0.021

Rank 4 · LXL04_017936 · OH-1004

Plastid0.016

Rank 5 · LXL04_017936 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03110.20SBP153-229 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017936	`PF03110.20`	SBP	153	229	2.9e-29	101.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FZK0`	Arabidopsis thaliana	Squamosa promoter-binding-like protein 11	37.801%	Swiss-Prot	moderate database homology
`Q8S9L0`	Arabidopsis thaliana	Squamosa promoter-binding-like protein 10	39.338%	Swiss-Prot	moderate database homology
`A2YGR5`	Oryza sativa subsp. indica	Squamosa promoter-binding-like protein 12	46.429%	Swiss-Prot	weak database homology
`Q5Z818`	Oryza sativa subsp. japonica	Squamosa promoter-binding-like protein 12	46.429%	Swiss-Prot	weak database homology
`A3A2Z8`	Oryza sativa subsp. japonica	Squamosa promoter-binding-like protein 3	33.788%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card