LXL04_017764 | RubberDandelionOmics

Gene overview

LXL04_017764

Reference: OH-1004 Chr: Chr04 Coordinates: 897877-900889 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1128 bp · LXL04_017764|LXL04_017764|OH1004|cDNA

ATGGAAGAAGAAAACAAATTAGGTCCCACAAGAACTCTAGAAAAAGAAAGAGGCCTGGGTGGACGAATACAATTTCGGCTTACAACAATGGCAAGTAATGCTGGTTCAAATGGAGAACAAAAAACTACGAAACCACCTCCAACCCCTTCTCCTTTACGTAACTCCAAATTCTTTCAGTCAAACATGCGGATCTTGGTTACTGGTGGTGCTGGATTTATCGGCTCTCATCTAGTCGATAAACTAATGGAAAATGAAAAGAA...

CDS

Download CDS FASTA

1128 bp · LXL04_017764|LXL04_017764|OH1004|CDS

ATGGAAGAAGAAAACAAATTAGGTCCCACAAGAACTCTAGAAAAAGAAAGAGGCCTGGGTGGACGAATACAATTTCGGCTTACAACAATGGCAAGTAATGCTGGTTCAAATGGAGAACAAAAAACTACGAAACCACCTCCAACCCCTTCTCCTTTACGTAACTCCAAATTCTTTCAGTCAAACATGCGGATCTTGGTTACTGGTGGTGCTGGATTTATCGGCTCTCATCTAGTCGATAAACTAATGGAAAATGAAAAGAA...

Protein

Download Protein FASTA

375 aa · LXL04_017764|LXL04_017764|OH1004|PROTEIN

MEEENKLGPTRTLEKERGLGGRIQFRLTTMASNAGSNGEQKTTKPPPTPSPLRNSKFFQSNMRILVTGGAGFIGSHLVDKLMENEKNEVIVADNYFTGSKDNLKKWIGHPRFELIRHDVTEALLVEVDQIYHLACPASPIFYKYNPVKTIKTNVIGTLNMLGLAKRVGARILLTSTSEVYGDPLVHPQPESYWGNVNPIGVRSCYDEGKRVAETLMFDYHRQHGIEIRIARIFNTYGPRMNIDDGRVVSNFIAQALRDEP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017764`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017764

Location Chr04:897877-900889 (-)

Description Similar to UXS5: UDP-glucuronic acid decarboxylase 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g46440`	Catalyzes the NAD-dependent decarboxylation of UDP-glucuronic acid to UDP-xylose.	No verified direct reference in this release
`At2g28760`	Catalyzes the NAD-dependent decarboxylation of UDP-glucuronic acid to UDP-xylose.	No verified direct reference in this release
`At5g59290`	Catalyzes the NAD-dependent decarboxylation of UDP-glucuronic acid to UDP-xylose.	Reconstruction of de novo pathway for synthesis of UDP-glucuronic acid and UDP-xylose from intrinsic UDP-glucose in Saccharomyces cerevisiae.2006 · DOI: 10.1111/j.1742-4658.2006.05281.x
`At2g47650`	Catalyzes the NAD-dependent decarboxylation of UDP-glucuronic acid to UDP-xylose.	No verified direct reference in this release
`At3g62830`	Catalyzes the NAD-dependent decarboxylation of UDP-glucuronic acid to UDP-xylose.	Biosynthesis of UDP-xylose: characterization of membrane-bound AtUxs2.2005 · DOI: 10.1007/s00425-004-1471-7

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017764 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0019305 dTDP-rhamnose biosynthetic process Biological Process

GO:0033320 UDP-D-xylose biosynthetic process Biological Process

GO:0042732 D-xylose metabolic process Biological Process

GO:0045492 xylan biosynthetic process Biological Process

GO:0000138 Golgi trans cisterna Cellular Component

GO:0000139 Golgi membrane Cellular Component

GO:0000325 plant-type vacuole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005768 endosome Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

KEGG gene cross-reference

ath:AT2G28760

ath:AT2G47650

ath:AT3G46440

ath:AT3G62830

ath:AT5G59290

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.595

Rank 1 · LXL04_017764 · OH-1004

Nucleus0.279

Rank 2 · LXL04_017764 · OH-1004

Plastid0.121

Rank 3 · LXL04_017764 · OH-1004

Mitochondrion0.092

Rank 4 · LXL04_017764 · OH-1004

Peroxisome0.077

Rank 5 · LXL04_017764 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04321.24RmlD_sub_bind62-317 aa

PF01370.28Epimerase64-298 aa

PF02719.22Polysacc_synt_264-173 aa

PF16363.12GDP_Man_Dehyd65-359 aa

PF01073.263Beta_HSD65-216 aa

PF07993.19NAD_binding_4119-234 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017764	`PF04321.24`	RmlD_sub_bind	62	317	1.1e-07	31.9
LXL04_017764	`PF01370.28`	Epimerase	64	298	7.1e-47	160.5
LXL04_017764	`PF02719.22`	Polysacc_synt_2	64	173	8.2e-14	52.2
LXL04_017764	`PF16363.12`	GDP_Man_Dehyd	65	359	3.4e-49	168.8
LXL04_017764	`PF01073.26`	3Beta_HSD	65	216	3.8e-12	46.5
LXL04_017764	`PF07993.19`	NAD_binding_4	119	234	3.1e-12	46.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SN95`	Arabidopsis thaliana	UDP-glucuronic acid decarboxylase 5	93.478%	Swiss-Prot	strong database homology
`Q9ZV36`	Arabidopsis thaliana	UDP-glucuronic acid decarboxylase 6	89.855%	Swiss-Prot	strong database homology
`Q9FIE8`	Arabidopsis thaliana	UDP-glucuronic acid decarboxylase 3	90.000%	Swiss-Prot	strong database homology
`Q8S8T4`	Arabidopsis thaliana	UDP-glucuronic acid decarboxylase 4	72.727%	Swiss-Prot	strong database homology
`Q9LZI2`	Arabidopsis thaliana	UDP-glucuronic acid decarboxylase 2	71.704%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card