LXL04_017681 | RubberDandelionOmics

Gene overview

LXL04_017681

Reference: OH-1004 Chr: Chr03 Coordinates: 156747044-156752525 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2396 bp · LXL04_017681|LXL04_017681|OH1004|cDNA

ATGAGCTTTAGAGGTGGACGTGACAGACATTGGAAGGACTATCCTTTGAGACCGGAAGAGAAAAGTCACCATGGCCGGAGCACTGCACCTCCTTCAAGACATCTGTGGGTTGGGAATCTATCTCATACCTTAACTGAACGTGCATTGAGCAATCACTTTAGACAATTTGGGGAGCTTGAAAGTGTAGGATTCTCACCTGGTCGTAGCTACGCCTTTGTCAATTTCATTGAAGTCAGTGCGGCTTTTGCAGCAATTGGAGC...

CDS

Download CDS FASTA

2211 bp · LXL04_017681|LXL04_017681|OH1004|CDS

ATGAGCTTTAGAGGTGGACGTGACAGACATTGGAAGGACTATCCTTTGAGACCGGAAGAGAAAAGTCACCATGGCCGGAGCACTGCACCTCCTTCAAGACATCTGTGGGTTGGGAATCTATCTCATACCTTAACTGAACGTGCATTGAGCAATCACTTTAGACAATTTGGGGAGCTTGAAAGTGTAGGATTCTCACCTGGTCGTAGCTACGCCTTTGTCAATTTCATTGAAGTCAGTGCGGCTTTTGCAGCAATTGGAGC...

Protein

Download Protein FASTA

736 aa · LXL04_017681|LXL04_017681|OH1004|PROTEIN

MSFRGGRDRHWKDYPLRPEEKSHHGRSTAPPSRHLWVGNLSHTLTERALSNHFRQFGELESVGFSPGRSYAFVNFIEVSAAFAAIGALQGFILAGNALRIEFTKAEKSPSRDEDDKYLHRRIRHSNSGSDPNYQNQKPSTKEDEEPNEVLWIGFPQSLKVDEHSFYTAFSPFGEIEKVSSYPGRTYAFVRYKHINSAIRAKDNLQGKLFGNPRVHITFARSESRALNPDPISPRYHDRSYHDEQRKPSSGRNHGFRDTGY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017681`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017681

Location Chr03:156747044-156752525 (+)

Description Similar to FPA: Flowering time control protein FPA

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g43410`	Plays a role in the regulation of flowering time in the autonomous flowering pathway by decreasing FLOWERING LOCUS C mRNA levels.	No verified direct reference in this release
`At5g54900`	Heterogeneous nuclear ribonucleoprotein (hnRNP)-protein binding the poly(A) tail of mRNA and probably involved in some steps of pre-mRNA maturation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017681 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process

GO:0000395 mRNA 5'-splice site recognition Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0001510 RNA methylation Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006397 mRNA processing Biological Process

GO:0006406 mRNA export from nucleus Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009553 embryo sac development Biological Process

GO:0009908 flower development Biological Process

GO:0009911 positive regulation of flower development Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

KEGG gene cross-reference

ath:AT2G43410

hsa:29890

spo:2540865

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.858

Rank 1 · LXL04_017681 · OH-1004

Cytoplasm0.228

Rank 2 · LXL04_017681 · OH-1004

Cell membrane0.045

Rank 3 · LXL04_017681 · OH-1004

Endoplasmic reticulum0.035

Rank 4 · LXL04_017681 · OH-1004

Plastid0.013

Rank 5 · LXL04_017681 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_135-99 aa

PF00076.29RRM_1160-213 aa

PF07744.20SPOC397-510 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017681	`PF00076.29`	RRM_1	35	99	3.6e-22	78.7
LXL04_017681	`PF00076.29`	RRM_1	160	213	3.6e-22	78.7
LXL04_017681	`PF07744.20`	SPOC	397	510	3.1e-25	89.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LPQ9`	Arabidopsis thaliana	Flowering time control protein FPA	37.879%	Swiss-Prot	weak database homology
`Q9FPJ8`	Arabidopsis thaliana	Polyadenylate-binding protein RBP45A	22.266%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card