LXL04_017591 | RubberDandelionOmics

Gene overview

LXL04_017591

Reference: OH-1004 Chr: Chr03 Coordinates: 154505972-154509012 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1461 bp · LXL04_017591|LXL04_017591|OH1004|cDNA

ATGACGTGTACTAATTTCATTGGTGAAAACACGTATCTCCCGTCCACGGTATCAAACACAAGAAGGGGTTTTTCTACTCTGCACCCGCAAGGTTTCTTCGTTTTCCGTTCGTCACTTCACCACTGTGTGTTTAAAAGCATGAATCGCTCGGGAAAAGTGTTGATCTTGATTTCTTTCTTCTTGTTATCAGCTAGCTCAAATTTAAATCTCGTTGATGCATTCTACGGAGCATCATCGCCAGTGGTTCAGCTCACTCCATC...

CDS

Download CDS FASTA

1461 bp · LXL04_017591|LXL04_017591|OH1004|CDS

ATGACGTGTACTAATTTCATTGGTGAAAACACGTATCTCCCGTCCACGGTATCAAACACAAGAAGGGGTTTTTCTACTCTGCACCCGCAAGGTTTCTTCGTTTTCCGTTCGTCACTTCACCACTGTGTGTTTAAAAGCATGAATCGCTCGGGAAAAGTGTTGATCTTGATTTCTTTCTTCTTGTTATCAGCTAGCTCAAATTTAAATCTCGTTGATGCATTCTACGGAGCATCATCGCCAGTGGTTCAGCTCACTCCATC...

Protein

Download Protein FASTA

486 aa · LXL04_017591|LXL04_017591|OH1004|PROTEIN

MTCTNFIGENTYLPSTVSNTRRGFSTLHPQGFFVFRSSLHHCVFKSMNRSGKVLILISFFLLSASSNLNLVDAFYGASSPVVQLTPSNFKSKVVNSNSVVLVEFFAPWCGHCQALTPTWEKAASVLKGVATVAAIDADANPSIAQEYGIKGFPTIKVFVPGKPPVDYQGAREAKPIAEFALSQVKALLKDRLSGKTTSSGSSEKKSEPNLSVELTSSNFDETVVRSKDLWVVEFFAPWCGHCKKLAPEWKKAARNLQGKV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017591`
TK1151 ID	TkA02G022480
OH-1004 ID	LXL04_017591
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 90.535 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017591

Location Chr03:154505972-154509012 (+)

Description Similar to PDIL2-3: Protein disulfide isomerase-like 2-3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g04980`	Acts as a protein-folding catalyst that interacts with nascent polypeptides to catalyze the formation, isomerization, and reduction or oxidation of disulfide bonds.	No verified direct reference in this release
`At2g32920`	Acts as a protein-folding catalyst that interacts with nascent polypeptides to catalyze the formation, isomerization, and reduction or oxidation of disulfide bonds.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0451500`	Acts as a protein-folding catalyst that interacts with nascent polypeptides to catalyze the formation, isomerization, and reduction or oxidation of disulfide bonds.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017591 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0034976 response to endoplasmic reticulum stress Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005615 extracellular space Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005788 endoplasmic reticulum lumen Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005793 endoplasmic reticulum-Golgi intermediate compartment Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT1G04980

ath:AT2G32920

dosa:Os09g0451500

hsa:10130

pon:100173470

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.867

Rank 1 · LXL04_017591 · OH-1004

Cytoplasm0.109

Rank 2 · LXL04_017591 · OH-1004

Golgi apparatus0.076

Rank 3 · LXL04_017591 · OH-1004

Nucleus0.070

Rank 4 · LXL04_017591 · OH-1004

Cell membrane0.041

Rank 5 · LXL04_017591 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00085.27Thioredoxin81-179 aa

PF04756.20OST3_OST6206-298 aa

PF00085.27Thioredoxin212-310 aa

PF13848.13Thioredoxin_6245-432 aa

PF24541.2Thioredox_PDIA6_C319-435 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017591	`PF00085.27`	Thioredoxin	81	179	1e-62	209.3
LXL04_017591	`PF04756.20`	OST3_OST6	206	298	8e-10	39.3
LXL04_017591	`PF00085.27`	Thioredoxin	212	310	1e-62	209.3
LXL04_017591	`PF13848.13`	Thioredoxin_6	245	432	2.5e-11	44.5
LXL04_017591	`PF24541.2`	Thioredox_PDIA6_C	319	435	1.9e-10	41.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9MAU6`	Arabidopsis thaliana	Protein disulfide-isomerase like 2-2	74.941%	Swiss-Prot	strong database homology
`O48773`	Arabidopsis thaliana	Protein disulfide-isomerase 2-3	73.697%	Swiss-Prot	strong database homology
`Q67UF5`	Oryza sativa subsp. japonica	Protein disulfide isomerase-like 2-3	76.627%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card