LXL04_017514 | RubberDandelionOmics

Gene overview

LXL04_017514

Reference: OH-1004 Chr: Chr03 Coordinates: 152339422-152341298 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1074 bp · LXL04_017514|LXL04_017514|OH1004|cDNA

ATGCTTCATTTTCCCGCCACAAAAATGCTCTCTCAATCTCACTTTTTCTCTCTAGATAATCGCCCTCGTTCTTCCCTATCTACAAATTATAGGACCTGCTGTTCGTCATCACTGTCGTCATCGCCATCGCCATTGTCAACCCTAGCCTTGACTAAATCTCGCCGAATCGTCTCAATGACTACAACGAGGTCGACACTCTCGGATGGAATTGGTGCGGTTTCGGGCGTCGAGCATAGCGGTTCTGAACTCGATCGTTTTGC...

CDS

Download CDS FASTA

1074 bp · LXL04_017514|LXL04_017514|OH1004|CDS

ATGCTTCATTTTCCCGCCACAAAAATGCTCTCTCAATCTCACTTTTTCTCTCTAGATAATCGCCCTCGTTCTTCCCTATCTACAAATTATAGGACCTGCTGTTCGTCATCACTGTCGTCATCGCCATCGCCATTGTCAACCCTAGCCTTGACTAAATCTCGCCGAATCGTCTCAATGACTACAACGAGGTCGACACTCTCGGATGGAATTGGTGCGGTTTCGGGCGTCGAGCATAGCGGTTCTGAACTCGATCGTTTTGC...

Protein

Download Protein FASTA

357 aa · LXL04_017514|LXL04_017514|OH1004|PROTEIN

MLHFPATKMLSQSHFFSLDNRPRSSLSTNYRTCCSSSLSSSPSPLSTLALTKSRRIVSMTTTRSTLSDGIGAVSGVEHSGSELDRFANVANKLADAAGDVIRQYFRKRFDIIDKEDLSPVTIADRAAEEAMISIIQESLPSHAIYGEENGWQCTEKSADYVWVLDPIDGTKSFITGRFRASTLLYSGKPVFGILIALLHRGKPILGVIDQPILRERWVGLTGRITKLNGEEISTRNCPKLSQAYLYTTSPHLFSGDAEVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017514`
TK1151 ID	TkA02G037190
OH-1004 ID	LXL04_017514
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017514

Location Chr03:152339422-152341298 (+)

Description Similar to HISN7: Bifunctional phosphatase IMPL2, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g39120`	Phosphatase required for histidine production.	The missing link in plant histidine biosynthesis: Arabidopsis myoinositol monophosphatase-like2 encodes a functional histidinol-phosphate phosphatase.2010 · DOI: 10.1104/pp.109.150805 Expression and functions of myo-inositol monophosphatase family genes in seed development of Arabidopsis.2011 · DOI: 10.1007/s10265-010-0381-y

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017514 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000105 L-histidine biosynthetic process Biological Process

GO:0006020 inositol metabolic process Biological Process

GO:0006021 inositol biosynthetic process Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0007165 signal transduction Biological Process

GO:0031564 transcription antitermination Biological Process

GO:0042254 ribosome biogenesis Biological Process

GO:0046854 phosphatidylinositol phosphate biosynthetic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0004401 histidinol-phosphatase activity Molecular Function

KEGG gene cross-reference

ath:AT4G39120

cgb:cg0910

cgl:Cgl0799

pae:PA3818

pmu:PM0315

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.974

Rank 1 · LXL04_017514 · OH-1004

Mitochondrion0.041

Rank 2 · LXL04_017514 · OH-1004

Cytoplasm0.034

Rank 3 · LXL04_017514 · OH-1004

Peroxisome0.025

Rank 4 · LXL04_017514 · OH-1004

Nucleus0.023

Rank 5 · LXL04_017514 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00459.31Inositol_P83-334 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017514	`PF00459.31`	Inositol_P	83	334	9e-58	196.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6NPM8`	Arabidopsis thaliana	Bifunctional phosphatase IMPL2, chloroplastic	64.641%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card