LXL04_017510 | RubberDandelionOmics

Gene overview

LXL04_017510

Reference: OH-1004 Chr: Chr03 Coordinates: 152298426-152301775 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1038 bp · LXL04_017510|LXL04_017510|OH1004|cDNA

ATGGTGAAAGACACAGAATATTACGACATCTTGGGAGTCAGTACTGATGCATCTGCATCCGATATCAAAAAGGCCTACTATGTCAAAGCAAGAAAAGTTCACCCTGATAAAAACCCTGGCGACCCCAAAGCTGCCCAAAATTTCCAGGAGCTTGGAGAGGCGTATCAGGTTCTAAGTGATCCTGAAAAGCGTGAAGCATATGACAAGAATGGAAAAGCTGGAGTACCAAATGAATCAATGGTGGATCCTGCAGCTGTATT...

CDS

Download CDS FASTA

1020 bp · LXL04_017510|LXL04_017510|OH1004|CDS

ATGGTGAAAGACACAGAATATTACGACATCTTGGGAGTCAGTACTGATGCATCTGCATCCGATATCAAAAAGGCCTACTATGTCAAAGCAAGAAAAGTTCACCCTGATAAAAACCCTGGCGACCCCAAAGCTGCCCAAAATTTCCAGGAGCTTGGAGAGGCGTATCAGGTTCTAAGTGATCCTGAAAAGCGTGAAGCATATGACAAGAATGGAAAAGCTGGAGTACCAAATGAATCAATGGTGGATCCTGCAGCTGTATT...

Protein

Download Protein FASTA

339 aa · LXL04_017510|LXL04_017510|OH1004|PROTEIN

MVKDTEYYDILGVSTDASASDIKKAYYVKARKVHPDKNPGDPKAAQNFQELGEAYQVLSDPEKREAYDKNGKAGVPNESMVDPAAVFGMLFGSDQFEDYIGQLYMAAIQSVELEEEGQVPEIRKMKVQERMREFQKERETKLITILKNRLRPFVEGETKQFVNWATAEAHELSKAAFGEAMLHTIGYIYTRQAARELGKDKRLMKVPFIAEWVRDKGHQMKSQVSAASGAVSLIQIQEDLKKLNNSEGKEEQIMKAVESK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017510`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017510

Location Chr03:152298426-152301775 (+)

Description No functional description available

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g76700`	Plays a continuous role in plant development probably in the structural organization of compartments.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017510 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0006626 protein targeting to mitochondrion Biological Process

GO:0016558 protein import into peroxisome matrix Biological Process

GO:0045040 protein insertion into mitochondrial outer membrane Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005933 cellular bud Cellular Component

GO:0032153 cell division site Cellular Component

KEGG gene cross-reference

ath:AT1G76700

sce:YER048C

sce:YIR004W

spo:2540676

spo:2543672

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.524

Rank 1 · LXL04_017510 · OH-1004

Nucleus0.257

Rank 2 · LXL04_017510 · OH-1004

Mitochondrion0.229

Rank 3 · LXL04_017510 · OH-1004

Endoplasmic reticulum0.098

Rank 4 · LXL04_017510 · OH-1004

Cell membrane0.095

Rank 5 · LXL04_017510 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00226.37DnaJ6-68 aa

PF14308.12DnaJ-X135-324 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017510	`PF00226.37`	DnaJ	6	68	1.4e-27	96.2
LXL04_017510	`PF14308.12`	DnaJ-X	135	324	2e-52	178.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GYX8`	Arabidopsis thaliana	Chaperone protein dnaJ 10	55.799%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card