LXL04_017390 | RubberDandelionOmics

Gene overview

LXL04_017390

Reference: OH-1004 Chr: Chr03 Coordinates: 148077620-148078594 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

975 bp · LXL04_017390|LXL04_017390|OH1004|cDNA

ATGAAGCCCACCACCAAGTTCATCCTCCTCCACCCTTCCATCCACAAGCAGGCCGGTACCGGTGTCGGTGGTGGTGGCGCCGGAGCTCCACATTCTCACCACCGTCTCTGGATTTTCACTCTTCTATCCCTACTCTCCTTCGCCTTAACATTTTCCCTCTTCACTACACTCCCATACTCCAGAACCACCGCCTCCTCCGCCGCTGCCGCCGCTTCCTCACCGCCTTTACCGAAACCCGTGTTTGACGCTCTTCTCCACTA...

CDS

Download CDS FASTA

975 bp · LXL04_017390|LXL04_017390|OH1004|CDS

ATGAAGCCCACCACCAAGTTCATCCTCCTCCACCCTTCCATCCACAAGCAGGCCGGTACCGGTGTCGGTGGTGGTGGCGCCGGAGCTCCACATTCTCACCACCGTCTCTGGATTTTCACTCTTCTATCCCTACTCTCCTTCGCCTTAACATTTTCCCTCTTCACTACACTCCCATACTCCAGAACCACCGCCTCCTCCGCCGCTGCCGCCGCTTCCTCACCGCCTTTACCGAAACCCGTGTTTGACGCTCTTCTCCACTA...

Protein

Download Protein FASTA

324 aa · LXL04_017390|LXL04_017390|OH1004|PROTEIN

MKPTTKFILLHPSIHKQAGTGVGGGGAGAPHSHHRLWIFTLLSLLSFALTFSLFTTLPYSRTTASSAAAAASSPPLPKPVFDALLHYAGSTSNTTNPARMSSAELNTIASVLRRCSTSSPTPCNLLVFGLTHETLLWHALNINGRTTFVDESAYFISKLEEKNPGIEAYDVQFTTKVSDLHELVSYAKSELRGECKPVQNLLFSECKLAINDLPNHVYDVAWDAILIDGPRGYFPKAPGRLSAIFTAGVLARSKTSGADK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017390`
TK1151 ID	TkA08G178350
OH-1004 ID	LXL04_017390
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	96.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017390

Location Chr03:148077620-148078594 (-)

Description Similar to IRX15-L: Protein IRX15-LIKE

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g67210`	Required for xylan biosynthesis, but not directly involved in catalyzing the addition of sugars to the growing polymer.	The DUF579 domain containing proteins IRX15 and IRX15-L affect xylan synthesis in Arabidopsis.2011 · DOI: 10.1111/j.1365-313x.2010.04475.x
`At3g50220`	Required for xylan biosynthesis, but not directly involved in catalyzing the addition of sugars to the growing polymer.	Arabidopsis genes IRREGULAR XYLEM (IRX15) and IRX15L encode DUF579-containing proteins that are essential for normal xylan deposition in the secondary cell wall.2011 · DOI: 10.1111/j.1365-313x.2011.04501.x The DUF579 domain containing proteins IRX15 and IRX15-L affect xylan synthesis in Arabidopsis.2011 · DOI: 10.1111/j.1365-313x.2010.04475.x
`At1g09610`	Methyltransferase catalyzing 4-O-methylation of glucuronic acid side chains on xylan.	Three Arabidopsis DUF579 domain-containing GXM proteins are methyltransferases catalyzing 4-o-methylation of glucuronic acid on xylan.2012 · DOI: 10.1093/pcp/pcs138
`At1g33800`	Methyltransferase catalyzing 4-O-methylation of glucuronic acid side chains on xylan.	Three Arabidopsis DUF579 domain-containing GXM proteins are methyltransferases catalyzing 4-o-methylation of glucuronic acid on xylan.2012 · DOI: 10.1093/pcp/pcs138
`At4g09990`	Methyltransferase catalyzing 4-O-methylation of glucuronic acid side chains on xylan.	Three Arabidopsis DUF579 domain-containing GXM proteins are methyltransferases catalyzing 4-o-methylation of glucuronic acid on xylan.2012 · DOI: 10.1093/pcp/pcs138

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017390 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005976 polysaccharide metabolic process Biological Process

GO:0009808 lignin metabolic process Biological Process

GO:0009834 plant-type secondary cell wall biogenesis Biological Process

GO:0032259 methylation Biological Process

GO:0045491 xylan metabolic process Biological Process

GO:0045492 xylan biosynthetic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0030775 glucuronoxylan 4-O-methyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT1G09610

ath:AT1G33800

ath:AT3G50220

ath:AT4G09990

ath:AT5G67210

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.548

Rank 1 · LXL04_017390 · OH-1004

Endoplasmic reticulum0.114

Rank 2 · LXL04_017390 · OH-1004

Cell membrane0.108

Rank 3 · LXL04_017390 · OH-1004

Extracellular0.095

Rank 4 · LXL04_017390 · OH-1004

Nucleus0.063

Rank 5 · LXL04_017390 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21729.4IRX15_IRX15L_GXM104-296 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017390	`PF21729.4`	IRX15_IRX15L_GXM	104	296	3.3e-76	255.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FH92`	Arabidopsis thaliana	Protein IRX15-LIKE	49.686%	Swiss-Prot	moderate database homology
`Q9SNE5`	Arabidopsis thaliana	Protein IRREGULAR XYLEM 15	46.269%	Swiss-Prot	moderate database homology
`Q6NMK1`	Arabidopsis thaliana	Glucuronoxylan 4-O-methyltransferase 1	37.238%	Swiss-Prot	moderate database homology
`Q9LQ32`	Arabidopsis thaliana	Glucuronoxylan 4-O-methyltransferase 3	41.256%	Swiss-Prot	moderate database homology
`Q9T0F7`	Arabidopsis thaliana	Glucuronoxylan 4-O-methyltransferase 2	39.910%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card