LXL04_017379 | RubberDandelionOmics

Gene overview

LXL04_017379

Reference: OH-1004 Chr: Chr03 Coordinates: 147886286-147887165 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

373 bp · LXL04_017379|LXL04_017379|OH1004|cDNA

ATGCATTTGAAGGATTGTAACCAATTGGTTGATGAACTGGAAAGTATAATCAAGAAATGTGAATATGGTGCTATTAAGTCGTACGATATTGCCTCGGCACTTAAGAGATACGAGCAAAAAAGAATGTTAAGGACAACGATTGTGCATGGGATGACCCGTATGGCATCAAAATCACTTACTAGCTACCAGCCTATGACATCCTTGTCGACACCTCGACTGCAGCTCCAAATTTCTACATATGTTTTACGATTGGTTCTACC...

CDS

Download CDS FASTA

348 bp · LXL04_017379|LXL04_017379|OH1004|CDS

ATGCATTTGAAGGATTGTAACCAATTGGTTGATGAACTGGAAAGTATAATCAAGAAATGTGAATATGGTGCTATTAAGTCGTACGATATTGCCTCGGCACTTAAGAGATACGAGCAAAAAAGAATGTTAAGGACAACGATTGTGCATGGGATGACCCGTATGGCATCAAAATCACTTACTAGCTACCAGCCTATGACATCCTTGTCGACACCTCGACTGCAGCTCCAAATTTCTACATATGTTTTACGATTGGTTCTACC...

Protein

Download Protein FASTA

115 aa · LXL04_017379|LXL04_017379|OH1004|PROTEIN

MHLKDCNQLVDELESIIKKCEYGAIKSYDIASALKRYEQKRMLRTTIVHGMTRMASKSLTSYQPMTSLSTPRLQLQISTYVLRLVLPYFMSWLVTGQVIGSLAINQFFVNLPQSL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017379`
TK1151 ID	TkA08G177780
OH-1004 ID	LXL04_017379
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	98.600
Protein coverage (%)	TK1151 72.549 / OH-1004 64.348 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017379

Location Chr03:147886286-147887165 (+)

Description Similar to ZEP: Zeaxanthin epoxidase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0448900`	Zeaxanthin epoxidase that plays an important role in the xanthophyll cycle and abscisic acid (ABA) biosynthesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017379 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009688 abscisic acid biosynthetic process Biological Process

GO:0016123 xanthophyll biosynthetic process Biological Process

GO:0050891 multicellular organismal-level water homeostasis Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0052662 zeaxanthin epoxidase activity Molecular Function

GO:0071949 FAD binding Molecular Function

KEGG gene cross-reference

dosa:Os04g0448900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.363

Rank 1 · LXL04_017379 · OH-1004

Cytoplasm0.283

Rank 2 · LXL04_017379 · OH-1004

Nucleus0.280

Rank 3 · LXL04_017379 · OH-1004

Cell membrane0.077

Rank 4 · LXL04_017379 · OH-1004

Endoplasmic reticulum0.070

Rank 5 · LXL04_017379 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0JCU7`	Oryza sativa subsp. japonica	Zeaxanthin epoxidase, chloroplastic	29.907%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card