LXL04_017073 | RubberDandelionOmics

Gene overview

LXL04_017073

Reference: OH-1004 Chr: Chr03 Coordinates: 140602586-140606188 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1803 bp · LXL04_017073|LXL04_017073|OH1004|cDNA

ATGGTCGAGCGAATTGGAATCACTAATGAGAGTATCAAGGATGACGACGAGCTGGAATTGTTGTTGGGTGAGATCCCTCATGCAACATCATCACTTACCCACCATCATCATCACCCATCACATGTCAATGATAATGGTTACGACCCTGTTCTATCTCAGACCATTAATGGAACGATGTATGGTATGTATGATGATGACCCATCATGCAGTTACAAGCAGAATTCATGTATTTTCCCTGCTACCAATGGCTCCTTTTCAAG...

CDS

Download CDS FASTA

1803 bp · LXL04_017073|LXL04_017073|OH1004|CDS

ATGGTCGAGCGAATTGGAATCACTAATGAGAGTATCAAGGATGACGACGAGCTGGAATTGTTGTTGGGTGAGATCCCTCATGCAACATCATCACTTACCCACCATCATCATCACCCATCACATGTCAATGATAATGGTTACGACCCTGTTCTATCTCAGACCATTAATGGAACGATGTATGGTATGTATGATGATGACCCATCATGCAGTTACAAGCAGAATTCATGTATTTTCCCTGCTACCAATGGCTCCTTTTCAAG...

Protein

Download Protein FASTA

600 aa · LXL04_017073|LXL04_017073|OH1004|PROTEIN

MVERIGITNESIKDDDELELLLGEIPHATSSLTHHHHHPSHVNDNGYDPVLSQTINGTMYGMYDDDPSCSYKQNSCIFPATNGSFSSFFSKDDPTPKPHMMFRTYSSILPYYGKKFDDNLFSELGNQGEDLVRDPNVGTNRINFSKPFSDYAVNQSHSSRFATEFSPFYGFQQIPPHRADNFFPQSHFNRNVLNLRYPVTYPRAIPSLYTAPQSEDSLIIHGETVNHVRNSHKVIGGFRGQIKKCSLHEKRSQVESNHNH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017073`
TK1151 ID	TkA02G076650
OH-1004 ID	LXL04_017073
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017073

Location Chr03:140602586-140606188 (-)

Description Similar to APUM7: Putative pumilio homolog 7, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g78160`	Sequence-specific RNA-binding protein that regulates translation and mRNA stability by binding the 3'-UTR of target mRNAs.	No verified direct reference in this release
`At1g22240`	Sequence-specific RNA-binding protein that regulates translation and mRNA stability by binding the 3'-UTR of target mRNAs.	No verified direct reference in this release
`At5g56510`	Sequence-specific RNA-binding protein that regulates translation and mRNA stability by binding the 3'-UTR of target mRNAs.	No verified direct reference in this release
`At4g08840`	Sequence-specific RNA-binding protein that regulates translation and mRNA stability by binding the 3'-UTR of target mRNAs.	No verified direct reference in this release
`At1g35730`	Sequence-specific RNA-binding protein that regulates translation and mRNA stability by binding the 3'-UTR of target mRNAs.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017073 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006417 regulation of translation Biological Process

GO:0010608 post-transcriptional regulation of gene expression Biological Process

GO:1902039 negative regulation of seed dormancy process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G22240

ath:AT1G35730

ath:AT1G78160

ath:AT4G08840

ath:AT5G56510

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.612

Rank 1 · LXL04_017073 · OH-1004

Nucleus0.445

Rank 2 · LXL04_017073 · OH-1004

Cell membrane0.092

Rank 3 · LXL04_017073 · OH-1004

Endoplasmic reticulum0.056

Rank 4 · LXL04_017073 · OH-1004

Plastid0.031

Rank 5 · LXL04_017073 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22493.3PUF_NOP9281-542 aa

PF00806.26PUF285-318 aa

PF00806.26PUF321-355 aa

PF00806.26PUF399-428 aa

PF00806.26PUF434-466 aa

PF00806.26PUF505-539 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017073	`PF22493.3`	PUF_NOP9	281	542	1.9e-21	77.3
LXL04_017073	`PF00806.26`	PUF	285	318	1.2e-62	207.5
LXL04_017073	`PF00806.26`	PUF	321	355	1.2e-62	207.5
LXL04_017073	`PF00806.26`	PUF	399	428	1.2e-62	207.5
LXL04_017073	`PF00806.26`	PUF	434	466	1.2e-62	207.5
LXL04_017073	`PF00806.26`	PUF	505	539	1.2e-62	207.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C9R6`	Arabidopsis thaliana	Putative pumilio homolog 7, chloroplastic	51.938%	Swiss-Prot	moderate database homology
`Q9LM20`	Arabidopsis thaliana	Putative pumilio homolog 8, chloroplastic	59.190%	Swiss-Prot	moderate database homology
`Q9LVC3`	Arabidopsis thaliana	Pumilio homolog 12	50.305%	Swiss-Prot	moderate database homology
`Q9LDW3`	Arabidopsis thaliana	Pumilio homolog 11	53.823%	Swiss-Prot	moderate database homology
`Q1PFN9`	Arabidopsis thaliana	Pumilio homolog 9	52.322%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card