LXL04_017044 | RubberDandelionOmics

Gene overview

LXL04_017044

Reference: OH-1004 Chr: Chr03 Coordinates: 139754900-139758357 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2322 bp · LXL04_017044|LXL04_017044|OH1004|cDNA

ATGGCTTCTCAGAATAAACAACACGTTCCTCTTCTTGCGATCACCCTCTTCCTCTTGATATGCTTGTCGTGCACAATCACAGTTTTTGCCCAATACTCCCCACGTTTTGCATGCGATATAGATAAAGATCCGACCTTGGAAATGTGCGCTTACTGTGATACTAAACTTGATATTAAAACACGGGTTGCTGACTTGCTAAGGAGGATGACATTGCAAGAAAAGGCGGGAAGCCTAGTGAGTGTAGCCGACGCCATCCCTAG...

CDS

Download CDS FASTA

2322 bp · LXL04_017044|LXL04_017044|OH1004|CDS

ATGGCTTCTCAGAATAAACAACACGTTCCTCTTCTTGCGATCACCCTCTTCCTCTTGATATGCTTGTCGTGCACAATCACAGTTTTTGCCCAATACTCCCCACGTTTTGCATGCGATATAGATAAAGATCCGACCTTGGAAATGTGCGCTTACTGTGATACTAAACTTGATATTAAAACACGGGTTGCTGACTTGCTAAGGAGGATGACATTGCAAGAAAAGGCGGGAAGCCTAGTGAGTGTAGCCGACGCCATCCCTAG...

Protein

Download Protein FASTA

773 aa · LXL04_017044|LXL04_017044|OH1004|PROTEIN

MASQNKQHVPLLAITLFLLICLSCTITVFAQYSPRFACDIDKDPTLEMCAYCDTKLDIKTRVADLLRRMTLQEKAGSLVSVADAIPRLGIPSYGWWSEALHGVSDTGPATWFNKTVIPGATSFPQVILTAASFNESLFYKIGQVVSTEARAMYNAGVAGLTFWSPNVNIFRDPRWGRGQETPGEDPLLASRYGATYVRGLQEREDGDKERLKVGACCKHFTAYDLDNWTSVDRFHFDAIVTKQDLEDTYNAPFKSCIFDG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017044`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017044

Location Chr03:139754900-139758357 (+)

Description Similar to Xyl2: Beta-xylosidase/alpha-L-arabinofuranosidase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g64570`	Beta-D-xylosidase showing an optimal efficiency with the natural substrate xylobiose.	No verified direct reference in this release
`At5g09730`	Involved in the hydrolysis of arabinan.	Purification, functional characterization, cloning, and identification of mutants of a seed-specific arabinan hydrolase in Arabidopsis.2006 · DOI: 10.1093/jxb/erj205
`At1g02640`	May be involved in remodeling of xylans during vascular development.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017044 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009627 systemic acquired resistance Biological Process

GO:0031222 arabinan catabolic process Biological Process

GO:0045493 xylan catabolic process Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005576 extracellular region Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0048046 apoplast Cellular Component

GO:0009044 xylan 1,4-beta-xylosidase activity Molecular Function

GO:0046556 alpha-L-arabinofuranosidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G02640

ath:AT5G09730

ath:AT5G64570

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.675

Rank 1 · LXL04_017044 · OH-1004

Lysosome / Vacuole0.113

Rank 2 · LXL04_017044 · OH-1004

Cell membrane0.078

Rank 3 · LXL04_017044 · OH-1004

Cytoplasm0.068

Rank 4 · LXL04_017044 · OH-1004

Endoplasmic reticulum0.050

Rank 5 · LXL04_017044 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00933.28Glyco_hydro_3117-361 aa

PF01915.28Glyco_hydro_3_C407-636 aa

PF14310.13Fn3-like699-762 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017044	`PF00933.28`	Glyco_hydro_3	117	361	2.2e-33	116.8
LXL04_017044	`PF01915.28`	Glyco_hydro_3_C	407	636	2.7e-50	171.8
LXL04_017044	`PF14310.13`	Fn3-like	699	762	4.2e-07	30.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLG1`	Arabidopsis thaliana	Beta-D-xylosidase 4	60.400%	Swiss-Prot	strong database homology
`Q9LXD6`	Arabidopsis thaliana	Beta-D-xylosidase 3	57.712%	Swiss-Prot	strong database homology
`Q94KD8`	Arabidopsis thaliana	Probable beta-D-xylosidase 2	52.687%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card