RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_017011
Reference: OH-1004 Chr: Chr03 Coordinates: 138839123-138840967 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1845 bp · LXL04_017011|LXL04_017011|OH1004|cDNA

ATGTCCATTGCCATACTAAAAACCATTTTCCACTATTTCTCGCTCACAGCAAACCCTTCcctccaccaaatcaaacaaacTCATGCCCGCCTCATCACCGCCGGGTACGACGGCGACACCCATTTCACTGGCCAACTCCTTGCCGCCTTAGCTCAGTCCCAATCAACCCCATTTCGGTATTCTCTTTCTATTCTCAATTCAACTCAAAACCCATCTCTTTTCGCTATCAATAACCTAATCCGATGCTGCGCCAAGAGCGA...

CDS

Download CDS FASTA

1845 bp · LXL04_017011|LXL04_017011|OH1004|CDS

ATGTCCATTGCCATACTAAAAACCATTTTCCACTATTTCTCGCTCACAGCAAACCCTTCCCTCCACCAAATCAAACAAACTCATGCCCGCCTCATCACCGCCGGGTACGACGGCGACACCCATTTCACTGGCCAACTCCTTGCCGCCTTAGCTCAGTCCCAATCAACCCCATTTCGGTATTCTCTTTCTATTCTCAATTCAACTCAAAACCCATCTCTTTTCGCTATCAATAACCTAATCCGATGCTGCGCCAAGAGCGA...

Protein

Download Protein FASTA

614 aa · LXL04_017011|LXL04_017011|OH1004|PROTEIN

MSIAILKTIFHYFSLTANPSLHQIKQTHARLITAGYDGDTHFTGQLLAALAQSQSTPFRYSLSILNSTQNPSLFAINNLIRCCAKSESPHEAFSLYSSMCKKPQFRPNNYTFSFLFQACSKFTGLTEGNQIQTHVIKLGFFDNVYIRNALIHLYFTSHDTKCAKDLFDECPSSRDLVTWNVMIAGYAKAGKINDVEKVFDEMPERDVISWSSLITGYMQNGYLEQALDSFKRMIDLQLSPNEAILVTVLSACAQLGLIEN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_017011
TK1151 IDTkA02G084210
OH-1004 IDLXL04_017011
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)92.100
Protein coverage (%)TK1151 100.000 / OH-1004 70.521
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_017011
LocationChr03:138839123-138840967 (+)
DescriptionSimilar to ELI1: Pentatricopeptide repeat-containing protein ELI1, chloroplastic
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g37380 Plays a major role in single RNA editing events in chloroplasts. No verified direct reference in this release
At5g66520 Pentatricopeptide repeat-containing protein At5g66520. No verified direct reference in this release
At1g74630 Pentatricopeptide repeat-containing protein At1g74630. No verified direct reference in this release
At5g40405 Putative pentatricopeptide repeat-containing protein At5g40405. No verified direct reference in this release
At3g62890 Pentatricopeptide repeat-containing protein At3g62890. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_017011 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006397 mRNA processing Biological Process
GO:0009451 RNA modification Biological Process
GO:0016554 cytidine to uridine editing Biological Process
GO:0031425 chloroplast RNA processing Biological Process
GO:1900865 chloroplast RNA modification Biological Process
GO:0005739 mitochondrion Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0003723 RNA binding Molecular Function
GO:0003729 mRNA binding Molecular Function
GO:0008270 zinc ion binding Molecular Function
KEGG gene cross-reference
ath:AT1G74630
ath:AT4G37380
ath:AT5G66520
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.653
Rank 1 · LXL04_017011 · OH-1004
Plastid0.178
Rank 2 · LXL04_017011 · OH-1004
Nucleus0.053
Rank 3 · LXL04_017011 · OH-1004
Cytoplasm0.039
Rank 4 · LXL04_017011 · OH-1004
Cell membrane0.005
Rank 5 · LXL04_017011 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13041.13PPR_271-121 aa
PF12854.14PPR_1174-202 aa
PF13041.13PPR_2175-206 aa
PF01535.27PPR177-206 aa
PF13041.13PPR_2205-252 aa
PF01535.27PPR208-235 aa
PF01535.27PPR281-304 aa
PF13041.13PPR_2307-354 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_017011PF13041.13PPR_2711211.7e-49166.4
LXL04_017011PF12854.14PPR_11742022.8e-2898.0
LXL04_017011PF13041.13PPR_21752061.7e-49166.4
LXL04_017011PF01535.27PPR1772063.8e-49162.3
LXL04_017011PF13041.13PPR_22052521.7e-49166.4
LXL04_017011PF01535.27PPR2082353.8e-49162.3
LXL04_017011PF01535.27PPR2813043.8e-49162.3
LXL04_017011PF13041.13PPR_23073541.7e-49166.4
LXL04_017011PF01535.27PPR3103383.8e-49162.3
LXL04_017011PF20431.5E_motif4284864.5e-1349.9
LXL04_017011PF14432.13DYW_deaminase5226145.9e-40135.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SZT8Arabidopsis thalianaPentatricopeptide repeat-containing protein ELI1, chloroplastic41.682%Swiss-Protmoderate database homology
Q9FJY7Arabidopsis thalianaPentatricopeptide repeat-containing protein At5g6652039.799%Swiss-Protmoderate database homology
Q9CA54Arabidopsis thalianaPentatricopeptide repeat-containing protein At1g7463037.599%Swiss-Protmoderate database homology
Q9FND7Arabidopsis thalianaPutative pentatricopeptide repeat-containing protein At5g4040537.438%Swiss-Protmoderate database homology
Q683I9Arabidopsis thalianaPentatricopeptide repeat-containing protein At3g6289041.379%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser