LXL04_017010 | RubberDandelionOmics

Gene overview

LXL04_017010

Reference: OH-1004 Chr: Chr03 Coordinates: 138835290-138836171 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

882 bp · LXL04_017010|LXL04_017010|OH1004|cDNA

ATGGGATACCTCAATTCATCCGTATCATCCGCCATAGCGGGTCAACCCAACGGTGAGTCACCCGTAAGTGGCGGCGGGTTAAGCCAAGACTCCAAATTCAGTTACGGGTTCGCCAGCTCACCGGGAAAACGGTCATCAATGGAGGATTTCTACGAGGCGAGAATCGACGGCGTGGACGGCGAAACCGTCGGATTATTCGGCGTCTTCGACGGCCACGGCGGCGCGCGTGCGGCCGAATACGTAAAACAACACCTCTTCAC...

CDS

Download CDS FASTA

882 bp · LXL04_017010|LXL04_017010|OH1004|CDS

ATGGGATACCTCAATTCATCCGTATCATCCGCCATAGCGGGTCAACCCAACGGTGAGTCACCCGTAAGTGGCGGCGGGTTAAGCCAAGACTCCAAATTCAGTTACGGGTTCGCCAGCTCACCGGGAAAACGGTCATCAATGGAGGATTTCTACGAGGCGAGAATCGACGGCGTGGACGGCGAAACCGTCGGATTATTCGGCGTCTTCGACGGCCACGGCGGCGCGCGTGCGGCCGAATACGTAAAACAACACCTCTTCAC...

Protein

Download Protein FASTA

293 aa · LXL04_017010|LXL04_017010|OH1004|PROTEIN

MGYLNSSVSSAIAGQPNGESPVSGGGLSQDSKFSYGFASSPGKRSSMEDFYEARIDGVDGETVGLFGVFDGHGGARAAEYVKQHLFTNLIKHPKFISDTKAAIAEAYSHTDTEFLKSENNQNRDAGSTASTAILVGDRLLVANVGDSRAVISRGGKAFAVSRDHKPDQTDERQRIEDAGGFVMWAGTWRVGGVLAVSRAFGDKLLKQYVVADPEIQEEKVDNSLEFLILASDGLWDVVSNDEAVAMVGPIESPEEAANRL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017010`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017010

Location Chr03:138835290-138836171 (+)

Description Similar to WIN2: Probable protein phosphatase 2C 59

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g31750`	Protein phosphatase that modulates defense response to pathogenic bacteria, conferring resistance and promoting salicylic acid (SA) accumulation.	Arabidopsis proteins important for modulating defense responses to Pseudomonas syringae that secrete HopW1-1.2008 · DOI: 10.1111/j.1365-313x.2008.03439.x
`At5g24940`	Probable protein phosphatase 2C 71.	No verified direct reference in this release
`At5g10740`	Probable protein phosphatase 2C 69.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0149800`	Probable protein phosphatase 2C 10.	No verified direct reference in this release
`Os06g0698300`	Probable protein phosphatase 2C 59.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017010 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006470 protein dephosphorylation Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:1902531 regulation of intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0016020 membrane Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT4G31750

ath:AT5G10740

ath:AT5G24940

dosa:Os02g0149800

dosa:Os06g0698300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.540

Rank 1 · LXL04_017010 · OH-1004

Nucleus0.424

Rank 2 · LXL04_017010 · OH-1004

Cell membrane0.165

Rank 3 · LXL04_017010 · OH-1004

Endoplasmic reticulum0.068

Rank 4 · LXL04_017010 · OH-1004

Lysosome / Vacuole0.065

Rank 5 · LXL04_017010 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481.27PP2C35-273 aa

PF13672.12PP2C_278-250 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017010	`PF00481.27`	PP2C	35	273	2.5e-66	224.6
LXL04_017010	`PF13672.12`	PP2C_2	78	250	4e-06	27.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RXV3`	Arabidopsis thaliana	Probable protein phosphatase 2C 59	82.253%	Swiss-Prot	strong database homology
`Q4PSE8`	Arabidopsis thaliana	Probable protein phosphatase 2C 71	78.369%	Swiss-Prot	strong database homology
`Q8LAY8`	Arabidopsis thaliana	Probable protein phosphatase 2C 69	78.799%	Swiss-Prot	strong database homology
`Q67UX7`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 10	83.643%	Swiss-Prot	strong database homology
`Q5Z6F5`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 59	84.314%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card