LXL04_016941 | RubberDandelionOmics

Gene overview

LXL04_016941

Reference: OH-1004 Chr: Chr03 Coordinates: 137312427-137315166 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1615 bp · LXL04_016941|LXL04_016941|OH1004|cDNA

TGGAACTTTTGTGTCAAGCCACCCAGCTCCCAGTACCATTCTACCATTccacacacactctctctctctctctctctctctctctctccaagCTCCATCAATGGCGAAGCAACGATCTTCTTCGCTATTCTTCTCTTCACTATTAACCCCGAGAGGCGACACCCTTCTCTACCTCATCGCTCTCCTCTCGATCTTCTCTCTCGTACTCCACCACATCTCCCTCTCCGCCGCCGCCGATTCCCACTTCGAAGGTTTCGAAG...

CDS

Download CDS FASTA

1515 bp · LXL04_016941|LXL04_016941|OH1004|CDS

ATGGCGAAGCAACGATCTTCTTCGCTATTCTTCTCTTCACTATTAACCCCGAGAGGCGACACCCTTCTCTACCTCATCGCTCTCCTCTCGATCTTCTCTCTCGTACTCCACCACATCTCCCTCTCCGCCGCCGCCGATTCCCACTTCGAAGGTTTCGAAGCCGATGACGAAGTTGAACTCGATGACGACTCTCTTTCATTCCAATCTTCCATCTCTGATCTCCCCCGCCGCTCCCCTCCTCCTTCCACCACTCTATCTAC...

Protein

Download Protein FASTA

504 aa · LXL04_016941|LXL04_016941|OH1004|PROTEIN

MAKQRSSSLFFSSLLTPRGDTLLYLIALLSIFSLVLHHISLSAAADSHFEGFEADDEVELDDDSLSFQSSISDLPRRSPPPSTTLSTPSDPESHHGPPSPPSSQPADSDLPTKPSTSSSSFDYWDEDEFEGFPTEIAPPEVSKITEPTTPAGSESADVDGAETIAQPTSTKKTIGSFTVEIISVSILIVFAINYFTGKKENETLALAWAAKFATNDSIFEKNFSLLGVGETEDSPLLLKEGQNVFKFYASGRRFCQGLLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016941`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016941

Location Chr03:137312427-137315166 (+)

Description Similar to At5g49945: Uncharacterized protein At5g49945

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g49945`	Uncharacterized protein At5g49945.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016941 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006983 ER overload response Biological Process

GO:0007029 endoplasmic reticulum organization Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0032469 endoplasmic reticulum calcium ion homeostasis Biological Process

GO:0036503 ERAD pathway Biological Process

GO:0045048 protein insertion into ER membrane Biological Process

GO:0055074 calcium ion homeostasis Biological Process

GO:0160063 multi-pass transmembrane protein insertion into ER membrane Biological Process

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005791 rough endoplasmic reticulum Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT5G49945

bta:540167

hsa:57003

mmu:67163

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.680

Rank 1 · LXL04_016941 · OH-1004

Golgi apparatus0.162

Rank 2 · LXL04_016941 · OH-1004

Nucleus0.146

Rank 3 · LXL04_016941 · OH-1004

Cytoplasm0.077

Rank 4 · LXL04_016941 · OH-1004

Plastid0.057

Rank 5 · LXL04_016941 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07946.20CCDC47176-493 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016941	`PF07946.20`	CCDC47	176	493	8.9e-81	272.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94CC0`	Arabidopsis thaliana	Uncharacterized protein At5g49945	59.062%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card