LXL04_016915 | RubberDandelionOmics

Gene overview

LXL04_016915

Reference: OH-1004 Chr: Chr03 Coordinates: 136832640-136833746 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

780 bp · LXL04_016915|LXL04_016915|OH1004|cDNA

ATGGCGTTCAATCTTCAAAACCCTTTTTCCATTTTCGTTTTGGTGTGTTCAATTGCTTCTCTTTTCCCAGGTCATCAACTCTTTGTATATGCCGATTATGGATTTTCCCCTGCTTTAGGAACATGGTATGGAAATCCACAAGGTTCTGGAAGTGGAGGAGCTTGTGGATGGGCTAACGATGTTCAGTCACCTCCTTTTTCATCCATGATCGCAGCCGGAAATTCAAGAATCTTTATGCAAGGAAAAGGCTGCGGAGATTG...

CDS

Download CDS FASTA

780 bp · LXL04_016915|LXL04_016915|OH1004|CDS

ATGGCGTTCAATCTTCAAAACCCTTTTTCCATTTTCGTTTTGGTGTGTTCAATTGCTTCTCTTTTCCCAGGTCATCAACTCTTTGTATATGCCGATTATGGATTTTCCCCTGCTTTAGGAACATGGTATGGAAATCCACAAGGTTCTGGAAGTGGAGGAGCTTGTGGATGGGCTAACGATGTTCAGTCACCTCCTTTTTCATCCATGATCGCAGCCGGAAATTCAAGAATCTTTATGCAAGGAAAAGGCTGCGGAGATTG...

Protein

Download Protein FASTA

259 aa · LXL04_016915|LXL04_016915|OH1004|PROTEIN

MAFNLQNPFSIFVLVCSIASLFPGHQLFVYADYGFSPALGTWYGNPQGSGSGGACGWANDVQSPPFSSMIAAGNSRIFMQGKGCGDCYQLKCNRQPYCSQNPITVTITDECPGLCNSVPFHFDLSGTAFGAMANPGQADNLRDLGQVDIQYRRVPCYYGNTKIAFKIDAKTNPNWFATAIEFDNGDGGLRAVEMATAGSQQFFAMKNIWGAVWEADVNPYMHGPFSFRITSESGKVVVAWNAVPNGFVPGRTYFSHVNF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016915`
TK1151 ID	TkA02G092950
OH-1004 ID	LXL04_016915
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016915

Location Chr03:136832640-136833746 (+)

Description Similar to EXPB15: Expansin-B15

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g65680`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0552000`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`Os05g0246300`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`Os02g0658600`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release
`Os04g0552200`	May cause loosening and extension of plant cell walls by disrupting non-covalent bonding between cellulose microfibrils and matrix glucans.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016915 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009826 unidimensional cell growth Biological Process

GO:0009828 plant-type cell wall loosening Biological Process

GO:0005576 extracellular region Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G65680

dosa:Os02g0658600

dosa:Os04g0552000

dosa:Os04g0552200

dosa:Os05g0246300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.443

Rank 1 · LXL04_016915 · OH-1004

Lysosome / Vacuole0.286

Rank 2 · LXL04_016915 · OH-1004

Cytoplasm0.133

Rank 3 · LXL04_016915 · OH-1004

Endoplasmic reticulum0.099

Rank 4 · LXL04_016915 · OH-1004

Cell membrane0.071

Rank 5 · LXL04_016915 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22514.3EXPB1_D141-156 aa

PF29515.1Expansin_N49-145 aa

PF03330.25DPBB_171-151 aa

PF01357.28Expansin_C163-244 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016915	`PF22514.3`	EXPB1_D1	41	156	3.2e-06	28.2
LXL04_016915	`PF29515.1`	Expansin_N	49	145	1.7e-07	32.1
LXL04_016915	`PF03330.25`	DPBB_1	71	151	1.1e-16	61.6
LXL04_016915	`PF01357.28`	Expansin_C	163	244	2.3e-19	70.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SHY6`	Arabidopsis thaliana	Putative expansin-B2	50.000%	Swiss-Prot	strong database homology
`Q7XT40`	Oryza sativa subsp. japonica	Expansin-B15	48.699%	Swiss-Prot	moderate database homology
`Q5W6Z9`	Oryza sativa subsp. japonica	Expansin-B18	52.252%	Swiss-Prot	strong database homology
`Q6H677`	Oryza sativa subsp. japonica	Putative expansin-B14	48.062%	Swiss-Prot	moderate database homology
`Q7XT39`	Oryza sativa subsp. japonica	Expansin-B5	51.724%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card