LXL04_016519 | RubberDandelionOmics

Gene overview

LXL04_016519

Reference: OH-1004 Chr: Chr03 Coordinates: 125292051-125296497 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2394 bp · LXL04_016519|LXL04_016519|OH1004|cDNA

ATGATAATGGAGCACTCATCTGAATTCGGTTCTTCAGAAGCTTCAATTCGAAACCCTCAACCAATTCCATCGGGCCATGATTCCGGAGTCATAACAGAGGAATGGAAACAGCGACTCCCAAGAAACCACAAAGACGTTGTTACCTTACGACAATGGTTAGATAACAGAAACCAAGTCGTTGATGCCTTTGAATGCTTGCATATATTTATACAAATTGTAGAAATTGTGAATTTATCACATTCGAAAGGAATTGTCGTTCA...

CDS

Download CDS FASTA

2394 bp · LXL04_016519|LXL04_016519|OH1004|CDS

ATGATAATGGAGCACTCATCTGAATTCGGTTCTTCAGAAGCTTCAATTCGAAACCCTCAACCAATTCCATCGGGCCATGATTCCGGAGTCATAACAGAGGAATGGAAACAGCGACTCCCAAGAAACCACAAAGACGTTGTTACCTTACGACAATGGTTAGATAACAGAAACCAAGTCGTTGATGCCTTTGAATGCTTGCATATATTTATACAAATTGTAGAAATTGTGAATTTATCACATTCGAAAGGAATTGTCGTTCA...

Protein

Download Protein FASTA

797 aa · LXL04_016519|LXL04_016519|OH1004|PROTEIN

MIMEHSSEFGSSEASIRNPQPIPSGHDSGVITEEWKQRLPRNHKDVVTLRQWLDNRNQVVDAFECLHIFIQIVEIVNLSHSKGIVVHNLRPSCFTISSLNHISFIEPVSCSDSDSGFTGSLQSGLENLDEDRNQRFQRLQMESNWYTSPEEANGGPSSCASDVYRLGALLFELYCMCSSMEEKKATMSSLRHRVFPPQLLLKWPKEALFCLWLLHPDPASRPKIDEVLKSEFLTGLKENLDERLAAIELKQRIEEQELLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016519`
TK1151 ID	TkA02G130820
OH-1004 ID	LXL04_016519
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.700
Protein coverage (%)	TK1151 99.252 / OH-1004 49.937 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016519

Location Chr03:125292051-125296497 (+)

Description Similar to SPA3: Protein SPA1-RELATED 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g15354`	Repressor of photomorphogenesis in the light.	The SPA1-like proteins SPA3 and SPA4 repress photomorphogenesis in the light.2003 · DOI: 10.1046/j.1365-313x.2003.01813.x Functional and expression analysis of Arabidopsis SPA genes during seedling photomorphogenesis and adult growth.2006 · DOI: 10.1111/j.1365-313x.2006.02812.x Arabidopsis SPA proteins regulate photoperiodic flowering and interact with the floral inducer CONSTANS to regulate its stability.2006 · DOI: 10.1242/dev.02481
`At1g53090`	Repressor of photomorphogenesis in the light.	The SPA1-like proteins SPA3 and SPA4 repress photomorphogenesis in the light.2003 · DOI: 10.1046/j.1365-313x.2003.01813.x Functional and expression analysis of Arabidopsis SPA genes during seedling photomorphogenesis and adult growth.2006 · DOI: 10.1111/j.1365-313x.2006.02812.x Arabidopsis SPA proteins regulate photoperiodic flowering and interact with the floral inducer CONSTANS to regulate its stability.2006 · DOI: 10.1242/dev.02481
`UniProt: Q9SYX2`	Controls normal photoperiodic flowering and regulates circadian rhythms.	No verified direct reference in this release
`At4g11110`	Involved in suppression of photomorphogenesis in dark-grown seedlings.	The SPA quartet: a family of WD-repeat proteins with a central role in suppression of photomorphogenesis in arabidopsis.2004 · DOI: 10.1105/tpc.104.024216 Functional and expression analysis of Arabidopsis SPA genes during seedling photomorphogenesis and adult growth.2006 · DOI: 10.1111/j.1365-313x.2006.02812.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016519 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009585 red, far-red light phototransduction Biological Process

GO:0009637 response to blue light Biological Process

GO:0009640 photomorphogenesis Biological Process

GO:0009658 chloroplast organization Biological Process

GO:0010017 red or far-red light signaling pathway Biological Process

GO:0010100 negative regulation of photomorphogenesis Biological Process

GO:0010114 response to red light Biological Process

GO:0010218 response to far red light Biological Process

GO:0048575 short-day photoperiodism, flowering Biological Process

GO:2000028 regulation of photoperiodism, flowering Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G53090

ath:AT2G46340

ath:AT3G15354

ath:AT4G11110

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.467

Rank 1 · LXL04_016519 · OH-1004

Cytoplasm0.419

Rank 2 · LXL04_016519 · OH-1004

Cell membrane0.086

Rank 3 · LXL04_016519 · OH-1004

Lysosome / Vacuole0.069

Rank 4 · LXL04_016519 · OH-1004

Golgi apparatus0.061

Rank 5 · LXL04_016519 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase49-233 aa

PF23389.2Beta-prop_WDR19_1st430-558 aa

PF25173.2Beta-prop_WDR3_1st435-567 aa

PF25175.2Beta-prop_WDR5436-561 aa

PF24796.2WDR55436-560 aa

PF25174.2Beta-prop_THOC3437-518 aa

PF25391.2WD40_Gbeta437-613 aa

PF23414.2Beta-prop_EML_2446-560 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016519	`PF00069.32`	Pkinase	49	233	1.1e-06	29.0
LXL04_016519	`PF23389.2`	Beta-prop_WDR19_1st	430	558	1.7e-08	34.6
LXL04_016519	`PF25173.2`	Beta-prop_WDR3_1st	435	567	2e-25	90.3
LXL04_016519	`PF25175.2`	Beta-prop_WDR5	436	561	1.7e-26	93.9
LXL04_016519	`PF24796.2`	WDR55	436	560	2.5e-12	47.2
LXL04_016519	`PF25174.2`	Beta-prop_THOC3	437	518	1e-22	81.2
LXL04_016519	`PF25391.2`	WD40_Gbeta	437	613	1.2e-09	38.3
LXL04_016519	`PF23414.2`	Beta-prop_EML_2	446	560	2.7e-17	63.7
LXL04_016519	`PF23775.2`	Beta-prop_RIG_2nd	448	518	2.6e-12	47.5
LXL04_016519	`PF24805.2`	EIF3I	481	588	6.1e-09	36.2
LXL04_016519	`PF24807.2`	WD40_CDC20-Fz	484	585	2.8e-24	86.7
LXL04_016519	`PF25174.2`	Beta-prop_THOC3	485	739	1e-22	81.2
LXL04_016519	`PF23609.2`	Beta-prop_EIPR1	485	555	1.3e-12	48.5
LXL04_016519	`PF29037.1`	DSE1_N	486	562	4.8e-11	43.1
LXL04_016519	`PF23381.2`	Beta-prop_IFT122_1st	489	563	3.7e-25	89.5
LXL04_016519	`PF24782.3`	WD40_MABP1-WDR62_2nd	499	570	1e-09	38.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LJR3`	Arabidopsis thaliana	Protein SPA1-RELATED 3	55.690%	Swiss-Prot	strong database homology
`Q94BM7`	Arabidopsis thaliana	Protein SPA1-RELATED 4	58.134%	Swiss-Prot	strong database homology
`Q9SYX2`	Arabidopsis thaliana	Protein SUPPRESSOR OF PHYA-105 1	41.763%	Swiss-Prot	moderate database homology
`Q9T014`	Arabidopsis thaliana	Protein SPA1-RELATED 2	41.580%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card