RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_016319
Reference: OH-1004 Chr: Chr03 Coordinates: 118698140-118700239 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

918 bp · LXL04_016319|LXL04_016319|OH1004|cDNA

ATGCGTGGGTCCAGTGTAGAACCTGGAGTCATCCCTTTAGCAGTTCATGACCTATTTGACATGATACAACAGGAAGTAGATCGTGAGTTTCTTTTAAGGATGTCATACATGGAGATTTACAATGAGGAAATTAATGATTTGTTGGCACCAGAACACCGAAAGCTGCAAATTCATGAAAGCATTGAGCGTGGTATATTTGTTGCTGGCTTAAAAGAAGAAATTGTTTCAAGCCCAAAACAAGTGCTTGAGTTCATGGATTT...

CDS

Download CDS FASTA

918 bp · LXL04_016319|LXL04_016319|OH1004|CDS

ATGCGTGGGTCCAGTGTAGAACCTGGAGTCATCCCTTTAGCAGTTCATGACCTATTTGACATGATACAACAGGAAGTAGATCGTGAGTTTCTTTTAAGGATGTCATACATGGAGATTTACAATGAGGAAATTAATGATTTGTTGGCACCAGAACACCGAAAGCTGCAAATTCATGAAAGCATTGAGCGTGGTATATTTGTTGCTGGCTTAAAAGAAGAAATTGTTTCAAGCCCAAAACAAGTGCTTGAGTTCATGGATTT...

Protein

Download Protein FASTA

305 aa · LXL04_016319|LXL04_016319|OH1004|PROTEIN

MRGSSVEPGVIPLAVHDLFDMIQQEVDREFLLRMSYMEIYNEEINDLLAPEHRKLQIHESIERGIFVAGLKEEIVSSPKQVLEFMDFGEAHRHIGETNMNLHSSRSHTIFRMSRDKVEYDHAESSCDAVRVSVLNLVDLAGSERAAKTGAEGVRLKEGSHINKSLMTLGTVIKKLSEGAESQGGHVPYRDSKLTRILQPALGGNANTAIICNITLAQFASRALRVTNCVHVNEILTDAALLKRQKKEIEELRAKLQPLAS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_016319
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_016319
LocationChr03:118698140-118700239 (+)
DescriptionSimilar to KIN7O: Kinesin-like protein KIN-7O
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
UniProt: F4J2K4 Kinesin-like protein KIN-7O. No verified direct reference in this release
At1g59540 Kinesin-like protein KIN-7N. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os09g0421200 Kinesin-like protein KIN-7I. No verified direct reference in this release
Os11g0552600 Kinesin-like protein KIN-7L. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_016319 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0000226 microtubule cytoskeleton organization Biological Process
GO:0000278 mitotic cell cycle Biological Process
GO:0007018 microtubule-based movement Biological Process
GO:0008608 attachment of spindle microtubules to kinetochore Biological Process
GO:0033044 regulation of chromosome organization Biological Process
GO:0042327 positive regulation of phosphorylation Biological Process
GO:0051301 cell division Biological Process
GO:0090307 mitotic spindle assembly Biological Process
GO:0140694 membraneless organelle assembly Biological Process
GO:1901987 regulation of cell cycle phase transition Biological Process
GO:0000775 chromosome, centromeric region Cellular Component
GO:0000776 kinetochore Cellular Component
KEGG gene cross-reference
ath:AT1G59540
ath:AT3G10180
ddi:DDB_G0285101
dosa:Os09g0421200
dosa:Os11g0552600
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.630
Rank 1 · LXL04_016319 · OH-1004
Nucleus0.397
Rank 2 · LXL04_016319 · OH-1004
Cell membrane0.087
Rank 3 · LXL04_016319 · OH-1004
Mitochondrion0.069
Rank 4 · LXL04_016319 · OH-1004
Golgi apparatus0.051
Rank 5 · LXL04_016319 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00225.30Kinesin1-217 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_016319PF00225.30Kinesin12171.5e-73248.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
F4J2K4Arabidopsis thalianaKinesin-like protein KIN-7O81.818%Swiss-Protstrong database homology
Q9S7P3Arabidopsis thalianaKinesin-like protein KIN-7N66.667%Swiss-Protstrong database homology
B9G3M6Oryza sativa subsp. japonicaKinesin-like protein KIN-7I81.818%Swiss-Protstrong database homology
Q2R2P7Oryza sativa subsp. japonicaKinesin-like protein KIN-7L66.667%Swiss-Protstrong database homology

JBrowse

View in Genome Browser