LXL04_016291 | RubberDandelionOmics

Gene overview

LXL04_016291

Reference: OH-1004 Chr: Chr03 Coordinates: 117562010-117565909 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3279 bp · LXL04_016291|LXL04_016291|OH1004|cDNA

ATGGCGTCTACTTCAGCTTCATATGTTCACAAAAGCTTTAAGTATGATGTGTTTTTGAGTTTTAGAGGTGAAGACACCCGAAAGCAGTTCGTTGATCATCTGTATTTTGCTCTTCAGCAAAAAGGCATTTACACTTATAAGGATGGCGAGAGAGTAAAGAAAGGGAAAAAGATCAGCAATGAGCTTATCCGATCCATTGAAGACTCAAAACTCTTCATCATTGTTTTCTCCAAGAACTATGTATCTTCTTCTTGGTGTTT...

CDS

Download CDS FASTA

3279 bp · LXL04_016291|LXL04_016291|OH1004|CDS

ATGGCGTCTACTTCAGCTTCATATGTTCACAAAAGCTTTAAGTATGATGTGTTTTTGAGTTTTAGAGGTGAAGACACCCGAAAGCAGTTCGTTGATCATCTGTATTTTGCTCTTCAGCAAAAAGGCATTTACACTTATAAGGATGGCGAGAGAGTAAAGAAAGGGAAAAAGATCAGCAATGAGCTTATCCGATCCATTGAAGACTCAAAACTCTTCATCATTGTTTTCTCCAAGAACTATGTATCTTCTTCTTGGTGTTT...

Protein

Download Protein FASTA

1092 aa · LXL04_016291|LXL04_016291|OH1004|PROTEIN

MASTSASYVHKSFKYDVFLSFRGEDTRKQFVDHLYFALQQKGIYTYKDGERVKKGKKISNELIRSIEDSKLFIIVFSKNYVSSSWCLDELVKIIECHKTNEHTAYPVFYDVEPCDIRKQSGVVGEVFSRHNNVDVAGKWREALKDAANLAGWELKSTADRNEAQFVQKIVENVSLELCSNNFSIDEKLVGIESRVKDVLSSLGTGFNDVRMIGIKGMGGGGKTTLARAVFDRISLQFEGKSFVENVREVSNTSLSGLKSL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016291`
TK1151 ID	TkA02G160840
OH-1004 ID	LXL04_016291
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	67.400
Protein coverage (%)	TK1151 44.660 / OH-1004 8.425 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016291

Location Chr03:117562010-117565909 (+)

Description Similar to RPV1: Disease resistance protein RPV1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g16950`	TIR-NB-LRR receptor-like protein that confers resistance to the pathogen Hyaloperonospora arabidopsis isolate Noco2 (downy mildew disease).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016291 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0043068 positive regulation of programmed cell death Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

GO:0043531 ADP binding Molecular Function

GO:0061809 NAD+ nucleosidase activity, cyclic ADP-ribose generating Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.450

Rank 1 · LXL04_016291 · OH-1004

Nucleus0.303

Rank 2 · LXL04_016291 · OH-1004

Cell membrane0.223

Rank 3 · LXL04_016291 · OH-1004

Endoplasmic reticulum0.090

Rank 4 · LXL04_016291 · OH-1004

Lysosome / Vacuole0.050

Rank 5 · LXL04_016291 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01582.26TIR14-177 aa

PF13676.12TIR_217-136 aa

PF00931.29NB-ARC195-302 aa

PF23282.2WHD_ROQ1387-431 aa

PF23622.2LRR_At1g61320_AtMIF1768-927 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016291	`PF01582.26`	TIR	14	177	5.3e-48	163.9
LXL04_016291	`PF13676.12`	TIR_2	17	136	1.1e-15	59.0
LXL04_016291	`PF00931.29`	NB-ARC	195	302	1.5e-11	44.9
LXL04_016291	`PF23282.2`	WHD_ROQ1	387	431	7.6e-10	39.5
LXL04_016291	`PF23622.2`	LRR_At1g61320_AtMIF1	768	927	7.6e-13	49.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JNB7`	Arabidopsis thaliana	Disease resistance protein RPP5	28.608%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card