LXL04_016205 | RubberDandelionOmics

Gene overview

LXL04_016205

Reference: OH-1004 Chr: Chr03 Coordinates: 115075072-115079566 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2448 bp · LXL04_016205|LXL04_016205|OH1004|cDNA

ATGTCTAGATTTGAAGGAGTTATTGTTTCTGATCATTGGCTACAAAGCCAGTTCACTCAAGTTCAACTTCGTAGCCTCAAATCCAAGTTTACAGCATTGAAGAATCAAAATGGGCAAGTTCTCGTTGATGATTTGCCAGCTTTGTTTCTGAAATTGAAGCCTTTCAGTGAGATGTTAACAGAGGATGAAATACGGGATGCGTTACATTCATCAGGTTCTGATAACAGTAACGAAGTGGAATTTGAAGAATTTCTCAGGGT...

CDS

Download CDS FASTA

2448 bp · LXL04_016205|LXL04_016205|OH1004|CDS

ATGTCTAGATTTGAAGGAGTTATTGTTTCTGATCATTGGCTACAAAGCCAGTTCACTCAAGTTCAACTTCGTAGCCTCAAATCCAAGTTTACAGCATTGAAGAATCAAAATGGGCAAGTTCTCGTTGATGATTTGCCAGCTTTGTTTCTGAAATTGAAGCCTTTCAGTGAGATGTTAACAGAGGATGAAATACGGGATGCGTTACATTCATCAGGTTCTGATAACAGTAACGAAGTGGAATTTGAAGAATTTCTCAGGGT...

Protein

Download Protein FASTA

815 aa · LXL04_016205|LXL04_016205|OH1004|PROTEIN

MSRFEGVIVSDHWLQSQFTQVQLRSLKSKFTALKNQNGQVLVDDLPALFLKLKPFSEMLTEDEIRDALHSSGSDNSNEVEFEEFLRVYVRLHSQGVTKSGDSKNSSSFLKATTTTLLHTIDESEKKSYVAHINSYLRDDPFMKQFLPIDPATNAFKLINMAVPNTIDERAINTKRKLNPWERNENHTLCLNSAKAIGCTVVNIGTQDLIEGRPHLVLGLISQIIKIQLLANLNLRKTPQLIELVEDNNDVEELMGLAPEK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016205`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016205

Location Chr03:115075072-115079566 (+)

Description Similar to FIM5: Fimbrin-5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g35700`	Cross-links actin filaments (F-actin) in a calcium independent manner.	Arabidopsis FIMBRIN5, an actin bundling factor, is required for pollen germination and pollen tube growth.2010 · DOI: 10.1105/tpc.110.080283
`At4g26700`	Cross-links actin filaments (F-actin) in a calcium independent manner.	AtFim1 is an actin filament crosslinking protein from Arabidopsis thaliana.2000 · DOI: 10.1046/j.1365-313x.2000.00907.x Fluorescently-labeled fimbrin decorates a dynamic actin filament network in live plant cells.2001 · DOI: 10.1007/s004250000494
`At5g55400`	Cross-links actin filaments (F-actin).	No verified direct reference in this release
`At2g04750`	Cross-links actin filaments (F-actin).	No verified direct reference in this release
`At5g48460`	Cross-links actin filaments (F-actin).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016205 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007623 circadian rhythm Biological Process

GO:0009846 pollen germination Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0030036 actin cytoskeleton organization Biological Process

GO:0051017 actin filament bundle assembly Biological Process

GO:0051639 actin filament network formation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005884 actin filament Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0032432 actin filament bundle Cellular Component

KEGG gene cross-reference

ath:AT2G04750

ath:AT4G26700

ath:AT5G35700

ath:AT5G48460

ath:AT5G55400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.568

Rank 1 · LXL04_016205 · OH-1004

Nucleus0.209

Rank 2 · LXL04_016205 · OH-1004

Cell membrane0.181

Rank 3 · LXL04_016205 · OH-1004

Golgi apparatus0.115

Rank 4 · LXL04_016205 · OH-1004

Mitochondrion0.100

Rank 5 · LXL04_016205 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00307.37CH156-225 aa

PF00307.37CH258-357 aa

PF00307.37CH384-486 aa

PF00307.37CH506-607 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016205	`PF00307.37`	CH	156	225	5.6e-75	249.3
LXL04_016205	`PF00307.37`	CH	258	357	5.6e-75	249.3
LXL04_016205	`PF00307.37`	CH	384	486	5.6e-75	249.3
LXL04_016205	`PF00307.37`	CH	506	607	5.6e-75	249.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FKI0`	Arabidopsis thaliana	Fimbrin-5	70.977%	Swiss-Prot	strong database homology
`Q7G188`	Arabidopsis thaliana	Fimbrin-1	70.381%	Swiss-Prot	strong database homology
`Q9FJ70`	Arabidopsis thaliana	Fimbrin-3	67.914%	Swiss-Prot	strong database homology
`Q9SJ84`	Arabidopsis thaliana	Fimbrin-4	68.053%	Swiss-Prot	strong database homology
`O50064`	Arabidopsis thaliana	Fimbrin-2	63.959%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card