LXL04_016188 | RubberDandelionOmics

Gene overview

LXL04_016188

Reference: OH-1004 Chr: Chr03 Coordinates: 113988400-113993972 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4401 bp · LXL04_016188|LXL04_016188|OH1004|cDNA

ATGAAAGATCCTGAAGCGGGTATTACAGTTAAGTATTCTCAGCTTTCAAATCTTTTGACCCCGAGACTCTTGCATGGGTTTTCCGGTTCAATATACCTTGGTTTTTTGCTTCTTTTATTCATCAATTGGCTCGGAAGAAATTTCAAAACCAATAATAGCAATACTCTTAGGTCCAACAAAGGTGTGTTTCATTACAAACGGACTCTGTTTTGTTGTGTTGTTCTTTTTCTTCTTAACCTCTGTGTGTGTTTATTTAATCT...

CDS

Download CDS FASTA

4401 bp · LXL04_016188|LXL04_016188|OH1004|CDS

ATGAAAGATCCTGAAGCGGGTATTACAGTTAAGTATTCTCAGCTTTCAAATCTTTTGACCCCGAGACTCTTGCATGGGTTTTCCGGTTCAATATACCTTGGTTTTTTGCTTCTTTTATTCATCAATTGGCTCGGAAGAAATTTCAAAACCAATAATAGCAATACTCTTAGGTCCAACAAAGGTGTGTTTCATTACAAACGGACTCTGTTTTGTTGTGTTGTTCTTTTTCTTCTTAACCTCTGTGTGTGTTTATTTAATCT...

Protein

Download Protein FASTA

1466 aa · LXL04_016188|LXL04_016188|OH1004|PROTEIN

MKDPEAGITVKYSQLSNLLTPRLLHGFSGSIYLGFLLLLFINWLGRNFKTNNSNTLRSNKGVFHYKRTLFCCVVLFLLNLCVCLFNLFYWYRNGRTYEHIIASRDSLLGTFVWLSVSVYFHTHVSNSKESTYPFVLRVWWVSFSLISCFSLFLDYVHYKHNKYLSPQFLVFEALSSFVSLFLCYVGFFDNNEYETIKPSTKSNFFSLLTFSWIDPLIAIGYKKPLDLEDVPQLASINTARGAFSVIKSKLESEKGENNEI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016188`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016188

Location Chr03:113988400-113993972 (-)

Description Similar to ABCC3: ABC transporter C family member 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g13080`	Pump for glutathione S-conjugates.	An ABC-transporter of Arabidopsis thaliana has both glutathione-conjugate and chlorophyll catabolite transport activity.1998 · DOI: 10.1046/j.1365-313x.1998.00076.x
`At3g13090`	Pump for glutathione S-conjugates.	No verified direct reference in this release
`At3g13100`	Pump for glutathione S-conjugates.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0142800`	ABC transporter that may affect phytic acid transport and compartmentalization.	Mutations of the multi-drug resistance-associated protein ABC transporter gene 5 result in reduction of phytic acid in rice seeds.2009 · DOI: 10.1007/s00122-009-1018-1
`UniProt: A2XCD4`	ABC transporter that may affect phytic acid transport and compartmentalization.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016188 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0051707 response to other organism Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0048046 apoplast Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0008559 ABC-type xenobiotic transporter activity Molecular Function

KEGG gene cross-reference

ath:AT3G13080

ath:AT3G13090

ath:AT3G13100

dosa:Os03g0142800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.343

Rank 1 · LXL04_016188 · OH-1004

Lysosome / Vacuole0.330

Rank 2 · LXL04_016188 · OH-1004

Endoplasmic reticulum0.173

Rank 3 · LXL04_016188 · OH-1004

Cytoplasm0.139

Rank 4 · LXL04_016188 · OH-1004

Golgi apparatus0.096

Rank 5 · LXL04_016188 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00664.29ABC_membrane277-542 aa

PF00005.34ABC_tran611-743 aa

PF00664.29ABC_membrane914-1135 aa

PF00005.34ABC_tran1226-1374 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016188	`PF00664.29`	ABC_membrane	277	542	7e-56	190.6
LXL04_016188	`PF00005.34`	ABC_tran	611	743	5.4e-50	170.3
LXL04_016188	`PF00664.29`	ABC_membrane	914	1135	7e-56	190.6
LXL04_016188	`PF00005.34`	ABC_tran	1226	1374	5.4e-50	170.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LK64`	Arabidopsis thaliana	ABC transporter C family member 3	59.249%	Swiss-Prot	strong database homology
`Q8VZZ4`	Arabidopsis thaliana	ABC transporter C family member 6	55.986%	Swiss-Prot	strong database homology
`Q9LK62`	Arabidopsis thaliana	ABC transporter C family member 7	54.286%	Swiss-Prot	strong database homology
`Q10RX7`	Oryza sativa subsp. japonica	ABC transporter C family member 13	49.820%	Swiss-Prot	moderate database homology
`A2XCD4`	Oryza sativa subsp. indica	ABC transporter C family member 13	49.820%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card