LXL04_016151 | RubberDandelionOmics

Gene overview

LXL04_016151

Reference: OH-1004 Chr: Chr03 Coordinates: 112296471-112297980 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

757 bp · LXL04_016151|LXL04_016151|OH1004|cDNA

ATGGATGATTCTTTGCCACTTGATAAGTTATCATTGGAGTCCACTGAGGAAAATAGTTCATCACATCCAAACACAAAGAGGAAAGTCCACATAGTACTGGTGTCAACCGGAAGCTTCAATCCTCCTACCTTCATGCATTTACGACTATTTGAATTGGCAAGGGATGCACTTAACTCAAAAGGGTATAATGTTGTTGGAGGTTATATGTCGCCTGTAAACCATGCATACCAGAAAAAGGGTCTCATACCATCCGAACATCG...

CDS

Download CDS FASTA

753 bp · LXL04_016151|LXL04_016151|OH1004|CDS

ATGGATGATTCTTTGCCACTTGATAAGTTATCATTGGAGTCCACTGAGGAAAATAGTTCATCACATCCAAACACAAAGAGGAAAGTCCACATAGTACTGGTGTCAACCGGAAGCTTCAATCCTCCTACCTTCATGCATTTACGACTATTTGAATTGGCAAGGGATGCACTTAACTCAAAAGGGTATAATGTTGTTGGAGGTTATATGTCGCCTGTAAACCATGCATACCAGAAAAAGGGTCTCATACCATCCGAACATCG...

Protein

Download Protein FASTA

250 aa · LXL04_016151|LXL04_016151|OH1004|PROTEIN

MDDSLPLDKLSLESTEENSSSHPNTKRKVHIVLVSTGSFNPPTFMHLRLFELARDALNSKGYNVVGGYMSPVNHAYQKKGLIPSEHRITMCQLACKSSDFVMVDSWEAKQTSFQRSLTVLSRIRSFFCDNGLIPTGSLKVMLVCGSDLLGSFGIPGAWIPDHIRIICRDYGVVCIRREGQDIEKIISRDDILTEYKSNIEVVDELVPNRISSTLVRDCVSRGLSVKYLTSDEVIDYIKRNQLYTNQERNS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016151`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016151

Location Chr03:112296471-112297980 (+)

Description Similar to NMNAT: Nicotinamide/nicotinic acid mononucleotide adenylyltransferase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g55810`	Catalyzes the formation of NAD(+) from nicotinamide mononucleotide (NMN) and ATP.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0814900`	Catalyzes the formation of NAD(+) from nicotinamide mononucleotide (NMN) and ATP.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016151 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009165 nucleotide biosynthetic process Biological Process

GO:0009435 NAD+ biosynthetic process Biological Process

GO:0009555 pollen development Biological Process

GO:0009611 response to wounding Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0034355 NAD+ biosynthetic process via the salvage pathway Biological Process

GO:0043410 positive regulation of MAPK cascade Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:1990966 ATP generation from poly-ADP-D-ribose Biological Process

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT5G55810

bta:522863

dosa:Os02g0814900

hsa:64802

mmu:66454

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.641

Rank 1 · LXL04_016151 · OH-1004

Nucleus0.555

Rank 2 · LXL04_016151 · OH-1004

Mitochondrion0.072

Rank 3 · LXL04_016151 · OH-1004

Peroxisome0.037

Rank 4 · LXL04_016151 · OH-1004

Cell membrane0.031

Rank 5 · LXL04_016151 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01467.33CTP_transf_like36-216 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016151	`PF01467.33`	CTP_transf_like	36	216	8.1e-17	62.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K687`	Arabidopsis thaliana	Nicotinamide/nicotinic acid mononucleotide adenylyltransferase	62.705%	Swiss-Prot	strong database homology
`Q0DWH7`	Oryza sativa subsp. japonica	Nicotinamide/nicotinic acid mononucleotide adenylyltransferase	59.671%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card